معلومة

اللطخة الغربية: ركيزة Fischer ECL 2: 1 بدلاً من 1: 1؟

اللطخة الغربية: ركيزة Fischer ECL 2: 1 بدلاً من 1: 1؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لقد قمت مؤخرًا بتطوير غشاء PVDF-WB-incubated PVDF-WB-b-actin-ab مع مجموعة Thermo Scientific Pierce ECL. وفقًا لأوامر المصنّعين ، قمت بخلط الكاشف 1 والكاشف 2 1: 1. لكن لسوء الحظ حصلت على نوع من العصابات "غير المتوازنة" (على الجانب الأيمن من الصورة). ثم أعطاني أحدهم نصيحة لمحاولة خلط الكواشف 2: 1. بالنسبة لهذه الركيزة ، حصلت على النتيجة على الجانب الأيسر والتي تبدو في الواقع أفضل بكثير. هل كان لدى أي شخص منكم نفس التجربة وهل يمكن لأي شخص أن يشرح لي سبب ذلك؟ هل القيام بذلك "قانوني" أم أنه يغير بطريقة ما نتائج تجربتي؟

تفضلوا بقبول فائق الاحترام ، p1ssn3lk3


حسنًا ، عادةً ما يكون أحد الكواشف في مجموعة ECL هو الركيزة والآخر هو بيروكسيد الهيدروجين ، الذي ينشط الركيزة للانهيار باستخدام HRP على الجسم المضاد الثانوي (Ab) ، لذلك أشك حقًا في أن ما تراه هو نتيجة فرق النسبة. من أجل الوصول إلى هذا الاستنتاج ، تحتاج إلى تشغيل عيناتك مرتين (على غشاءين منفصلين) وإجراء 1: 1 و 2: 1 ECL وإذا لاحظت مثل هذا الاختلاف فأنت على أسس أقوى.

أظن أن ما حدث في التجربة أعلاه هو أنك قمت بإجراء 1: 1 (مع عدم توزيع 1Ab و 2Ab بالتساوي على الغشاء) ثم بعد غسل ربما ليس جيدًا ، قمت بعمل حضانة أخرى 1Ab و 2 AB باستخدام 2: 1 مزيج. أظن أن ما حدث هو أنه في 1: 1 لم يتلق الجانب الأيسر خلطات Ab جيدًا وعندما فعلت 2: 1 نظرًا لأن اليد اليمنى لا تزال Ab ملتصقة بها (إذا لم تقم بتجريد الغشاء) ) لذلك تم "إجبار" الجانب الأيسر على الحصول على Abs وبالتالي فإن خليط Ab و ECL غير مرتبطين بشكل متساوٍ. من الواضح أن إحدى الصور تتعارض مع الأخرى ، لذا فقد سارت خطوة حضانة Ab بشكل خاطئ. خلاف ذلك ، إذا كنت قد انتهيت من خليط حضانة ECL الثاني مباشرة بعد الأول ولم تقم بخطوة الغسل ، فيمكن أن يحدث نفس الشيء إذا لم يتلق الغشاء خليط ECL الأولي بالتساوي حيث يمكنك الحصول على تأثير مانع بواسطة خليط ECL القديم وربما ما حدث هو أن H2O2 أو الركيزة كانت موجودة بشكل زائد في خطوة الحضانة الثانية وبالتالي تضخيم الإشارة في أقسام الغشاء التي لم تستقبل خليط ECL جيدًا في المقام الأول ، بالنسبة لبقية الغشاء ، الذي لا يزال يحتوي على سائل ECL عليه من التجربة الأخيرة (مرة أخرى إذا لم تغسل الغشاء جيدًا ، فيمكن أن يكون ECL نشطًا لمدة تصل إلى 24 ساعة في بعض المجموعات ، ولكن بعد بضع ساعات ، يقل النشاط عادةً ولكن لا يزال من الممكن أن يلاحظ)

ما عليك القيام به هو بعد ECL ، اغسل الغشاء باستخدام TBST لبضع دقائق متبوعًا بـ TBS ، اترك الغشاء في الشمس حتى يجف حتى يفسد Ab ببطء (على الرغم من أن هذا لا يحدث دائمًا بشكل خاص مع تقارب عالي Abs مثل كمضاد لتوبيولين وأكتين). بعد 24 ساعة على الأقل ، انزع الغشاء من Ab وأعد حضانة Ab. أفضل ما يمكنك فعله هو القيام بجميع خطوات الحضانة في كيس مغلق ثم التأكد من أن الغشاء يستقبل خليط ECL بالتساوي ويقوم بالتخيل. أود أن أقول مع ذلك ، نظرًا لأن الغشاء "ملوث" بشكل غير متساوٍ بالـ Abs ، فإن أفضل ما يمكن فعله هو إعادة التشغيل التجريبي وإعادة تشغيل الجل. إنه ألم ولكن عليك الوصول إلى زر هذا!


لدي مشكلة مماثلة. في حالتي ، أدركت أنه من الضروري تمامًا غسل الغشاء في TBS بدون Tween (TBS ، وليس TBST) قبل استخدام ECL. إذا كان لديك أي كمية من الصابون (توين) على غشاءك فإنه يتفاعل بطريقة ما مع ECL وفي كل مرة يجب أن تحصل على نمط مختلف من هذه البقع. لقد أحدث غسل الغشاء في TBS ثم احتضانه باستخدام ECL فرقًا بالنسبة لي وأصلح المشكلة.


حاول شطف البقعة في TBS أو PBS قبل العلاج. هزها وحاول وضعها على سطح جاف مستو. عندما أسكب كاشفًا كيميائيًا هناك ، أسكب فقط ما يكفي حتى يحافظ التوتر السطحي على السائل الموجود على الورق لا يسمح له بالجريان.

الاحتمالات الأخرى التي أراها يمكن أن تكون في نقلك. لا يمكن أن تكون درجة الحرارة موحدة في المخزن المؤقت


النتائج

يتم توزيع Lysine 2-hydroxyisobutyrylation على نطاق واسع في الفطريات المسببة للأمراض النباتية

لاستكشاف ما إذا كان أي من PTM التي تم تحديدها حديثًا موجودة في مسببات الأمراض الفطرية للنباتات ، أجرينا النشاف الغربي للكشف عن Kأ، succinylation (K.سوك) ، البنزويل (K.بن) ، و crotonylation (K.cro) و K.hib التعديلات في يو فيرينز باستخدام أجسام مضادة محددة. لاحظنا العصابات المقابلة للبروتينات التي تحتوي على هذه التعديلات على نطاق واسع من كتلة البروتين (الشكل 1 أ). إن PTMs Kسوك، كبن، كcro، و K.hib كانت جميعها وفيرة للغاية في U. virens، بينما K.أ كان الأقل وفرة.

الكشف عن التنميط اللايسين 2-هيدروكسي أيزوبوتيريل (K.hib) في Ustilaginoidea virens

(أ) تحليل اللطخة الغربية لـ K.أ، كسوك، كبن، كcro، و K.hib في U. virens. تم استخلاص البروتين باستخدام طريقة ترسيب TCA-acetone. تم تلوين هلام الصوديوم دوديسيل كبريتات بولي أكريلاميد الكهربائي (SDS-PAGE) باستخدام Coomassie Brilliant Blue (CBB) كعنصر تحكم في التحميل. (ب) تحليل اللطخة الغربية لـ K.hib في يو فيرينز, Magnaporthe oryzae, الحزام الفيوزاريوم, Sclerotinia sclerotiorum, ريزوكتونيا سولاني، و Colletotrichum higginsianum. تم استخراج البروتين مع محلول تحلل. (ج) نظرة عامة تخطيطية لسير العمل التجريبي لتحديد K.hib في يو فيرينز. (د) مخططات فين لـ K.hib مواقع (بروتينات) في U. virens تم تحديدها من 7 أيام من الفطريات المستزرعة وعينات زهرة الأرز المصابة في 6 أيام بعد الإصابة. (ه) التحليل الإحصائي للتنظيم بشكل كبير (تغيير أضعاف و GT1.5 ، ص & lt 0.05) والتنظيم السفلي (تغيير الطي & GT1.5 ، ص & lt 0.05) كhib مواقع يو فيرينز في العينات المصابة مقابل الفطريات المستزرعة. (F) توزيع بروتينات 2-hydroxyisobutyrylated على أساس عدد المواقع المعدلة.

لتقييم ما إذا كان حرف K.hib التعديل موجود في الفطريات المسببة للأمراض النباتية الأخرى ، أجرينا التكتل المناعي باستخدام K.hib تم تشغيل الجسم المضاد Magnaporthe oryzae (فطر الأرز) ، الحزام الفيوزاريوم (فطريات لفحة الرأس فيوزاريوم) ، Sclerotinia sclerotiorum (فطر Sclerotinia rot) ، ريزوكتونيا سولاني (فطريات غمد الأرز) ، و Colletotrichum higginsianum (فطر الأنثراكنوز الصليبي). كhib تم اكتشافه في مسببات الأمراض الفطرية هذه (الشكل 1 ب) ، مما يدل على أن K.hib منتشر على نطاق واسع في الفطريات المسببة للأمراض النباتية.

تحديد مواقع ليسين 2-هيدروكسي أيزوبوتيريل في U. virens

للتعرف على K.hib مواقع في يو فيرينز، أجرينا تحليلًا منهجيًا لـ K.hib من خلال الجمع بين الإثراء والتقارب وتقنيات البروتينات باستخدام البروتينات المعزولة من 7 د غصن مثقف وأنسجة زهرة الأرز المصابة في 6 د بعد التلقيح (نقطة في البوصة) (الشكل 1 ج). في المجموع ، تم تحديد 6170 ببتيدات 2-hydroxyisobutyrylated تشمل 3426 موقعًا من 977 بروتينًا بمعدل اكتشاف خاطئ 1٪ (FDR) ، منها 2884 موقعًا على 849 بروتينًا تحتوي على معلومات كمية (الجدول S1). كانت المواقع 2-hydroxyisobutyrylated المحددة في mycelia السائلة مماثلة لتلك التي تم تحديدها في عينات زهرة الأرز المصابة. لم يتم اكتشاف سوى ستة مواقع 2-hydroxyisobutyrylated في mycelia في عينات زهرة الأرز المصابة (الشكل 1D). من بين K القابلة للقياس الكميhib مواقع في جميع العينات ، 568 موقعًا على 313 بروتينًا من U. virens أظهر زيادة في أنسجة النبات المصابة (تغير الطية & gt1.5 ، ص & lt 0.05) ، بينما تم تنظيم 50 موقعًا على 38 بروتينًا (الشكل 1E). علاوة على ذلك ، لتحديد توزيع مواقع 2-hydroxyisobutyrylated داخل البروتينات الفردية ، قمنا بحساب عدد مواقع التعديل لكل بروتين ، وحددنا أن 425 بروتينًا معدلًا يحتوي على موقع واحد فقط 2-hydroxyisobutyrylated ، في حين أن 552 بروتينًا يحتوي على موقعين أو أكثر من مواقع التعديل (الشكل 1F). ). من بين البروتينات التي تحتوي على موقعين أو أكثر من مواقع التعديل ، تم تعديل 51 بروتينًا بشكل كبير وكان لديها أكثر من 10 مواقع 2-هيدروكسي أيزوبوتيريل. كانت البروتينات الأربعة الأولى التي تحتوي على 2 هيدروكسي أيزوبوتيريل هي سينثيز الميثيونين المستقل عن الكوبالامين (Uv8b_5222) ، وبروتين الصدمة الحرارية 70 (UV8b_555) ، وعامل الاستطالة 2 (Uv8b_5927) ، وثاني كبريتيد أيزوميراز (Uv8b_5623) (الجدول S1). علاوة على ذلك ، تم شرح 458 من 977 بروتينات 2-هيدروكسي أيزوبوتيريل كأنزيمات. من بين 458 إنزيمات 2-hydroxyisobutyrylated ، كان لدى 248 عدة Khib تم تعديل 38 موقعًا بشكل كبير (أكثر من 10 كhib المواقع) (الجدول S2). وهكذا ، نستنتج أن K.hib هو PTM شائع ومعقد في يو فيرينز.

تحليل مواقع ليسين 2-هيدروكسي أيزوبوتيريل

لتحديد ما إذا كانت هناك أشكال متسلسلة شائعة في K.hib الببتيدات ، قمنا بمحاذاة تسلسل الأحماض الأمينية المحيطة بـ K.hib مواقع ضد الجميع U. virens تسلسل الخلفية (الأشكال 2A ، S1). بناءً على اختبار فيشر الدقيق ، تم تمثيل الألانين (A) بشكل كبير في المواضع −4 و −3 و +1 و +4 (ص & lt 0.05). تم إثراء الغلوتامات (G) في المواضع −2 و −1 و +3 ، بينما تم إثراء ليسين (K) في المواضع −10 إلى −5 و +8 (ص & lt 0.05). حددنا أيضًا 28 كhib المواقع في هيستون ، كما هو الحال في ذيول N- الطرفية لـ H3 (K23 و K27 و K36) و H4 (K12 و K31) (الشكل 2 ب). كانت العديد من مواقع H2A و H2B عبارة عن 2-hydroxyisobutyrylated في يو فيرينز (الشكل 2 ب) بما في ذلك في الطرف N ، المجال الكروي ، والنهاية الطرفية للهيستونات الأساسية. وهكذا ، كشفت هذه النتائج شائعة ومتنوعة Khib مواقع في هيستونات U. virens.

توصيف ليسين 2-هيدروكسي أيزوبوتيريل (K.hib) بروتين في Ustilaginoidea virens

(أ) يُظهر شعار تسلسل الإجماع تسلسلًا تمثيليًا لجميع K.hib المواقع. يعكس حجم الحمض الأميني الاختلاف في تواتر الحمض الأميني في التجربة وتكراره في المجموعة المرجعية. ال ص- تم حساب قيمة كل حمض أميني في كل موضع عن طريق اختبار التردد التجريبي مقابل تكرار كل حمض أميني في المجموعة المرجعية مع اختبار فيشر الدقيق. في هذا الشعار ، فقط الأحماض الأمينية المهمة (ص & lt 0.05). (ب) رسم تخطيطي يوضح مواقع هيستون كhib المحددة في هذه الدراسة.

شرح وظيفي لبروتينات 2-هيدروكسي أيزوبوتيريل

لفهم الوظيفة المحتملة لـ K.hib في يو فيرينز، قمنا بالتحقيق في التصنيف الوظيفي لـ Gene Ontology (GO) لجميع البروتينات 2-hydroxyisobutyrylated (الجدول S3). أظهر تحليل التخصيب للعمليات البيولوجية أن البروتينات 2-hydroxyisobutyrylated كانت مرتبطة بعمليات التمثيل الغذائي المختلفة ، وعمليات التخليق الحيوي ، والتنفس ، ونقل الهيدروجين (الشكل 3 أ). ضمن مجموعة الوظيفة الجزيئية ، ارتبطت معظم البروتينات 2-hydroxyisobutyrylated بمكوِّن هيكلي جزيئي للريبوسومات ، أو نشاط حامل الإلكترون ، أو تشارك في النشاط الأنزيمي (الشكل 3 أ). في تصنيف المكونات الخلوية ، تم توزيع بروتينات 2-hydroxyisobutyrylated في السيتوبلازم والجزء السيتوبلازمي والعضيات غير المحصورة بالغشاء والريبوزومات (الشكل 3 أ).

الشرح الوظيفي للبروتينات 2-هيدروكسي أيزوبوتيريل في Ustilaginoidea virens

(أ) تحليل العمليات البيولوجية والوظائف الجزيئية والمكونات الخلوية لليسين 2-هيدروكسي أيزوبوتيريل (Khib) البروتينات. (ب) موسوعة كيوتو للجينات والجينوم (KEGG) تحليل إثراء مسار K.hib البروتينات. جميع المسارات ذات ص- تظهر القيمة & lt0.05. (ج) تنبؤات التوطين الخلوي لـ K.hib البروتينات.

لاستكشاف المسارات المحتملة المتأثرة بـ K.hib، أجرينا تحليل إثراء مسار موسوعة كيوتو للجينات والجينوم (KEGG) لـ Khib البروتينات (الجدول S4). تم إثراء مسارات الأيض المركزية المتعددة ، بما في ذلك الريبوسوم ، والتمثيل الغذائي للكربون ، ودورة TCA ، وتحلل السكر / استحداث السكر ، ومسارات استقلاب البيروفات (الشكل 3 ب). كانت نسبة كبيرة من الإنزيمات الأيضية في مسار فوسفات البنتوز ، ودورة TCA ، وتحلل الجلوكوز / استحداث السكر عبارة عن 2-hydroxyisobutyrylated ، بما في ذلك إنزيمات الجلوكوز 6-فوسفات أيزوميراز (PGI) ، ATP-6-phosphofructokinase (PFK) 1 (PGK1) و enolase (ENO1) وغيرها (الشكل S2).

توقع تحليل التعريب الخلوي باستخدام WoLF PSORT أنه من بين 977 K.hibالبروتينات المعدلة ، يقع معظمها في السيتوبلازم (31٪) ، الميتوكوندريا (27٪) ، أو النواة (21٪) (الشكل 3 ج). يسلط هذا التنوع في التوطين الخلوي الضوء على أنه إلى جانب بروتينات الهيستون في النواة ، تم تعديل بروتينات أخرى غير هيستون في عضيات مختلفة باستخدام Khib، والتي تتفق مع تحليل التخصيب البيولوجي.

شبكات تفاعل بروتينات 2-هيدروكسي أيزوبوتيريل

لتحديد ارتباط البروتينات 2-هيدروكسي أيزوبوتيريل مع بعضها البعض في يو فيرينز، أنشأنا شبكة تفاعل بروتين لجميع K.hibالبروتينات المنظمة بناءً على قاعدة بيانات STRING. شكلت البروتينات المعدلة البالغ عددها 977 شبكة بروتينية شديدة الترابط. بعد ذلك ، أظهر تحليل MCODE أن جميع البروتينات 2-hydroxyisobutyrylated كانت مرتبطة ارتباطًا وثيقًا. كما هو مبين في الشكل S3 ، شكلت العديد من المجمعات والوظائف الخلوية مجموعات بارزة ومترابطة للغاية ، بما في ذلك مجمع البروتين الريبوسومي والبروتيازوم. كانت هناك بعض البروتينات 2-hydroxyisobutyrylated المرتبطة بالضراوة والإجهاد ، بما في ذلك المكونات الهيكلية للريبوسوم ، وعوامل بدء الترجمة ، وبروتينات مسار البروتين كيناز (MAPK) ، والبروتينات المرتبطة بالتهوية الذاتية ، والسبتينات (الشكل 4A-E). تسلط هذه النتائج الضوء على المرشحين للتوصيف الوظيفي المستقبلي للأدوار المحتملة لـ K.hib في العمليات البيولوجية الهامة يو فيرينز.

شبكات التفاعل من البروتينات 2-هيدروكسي أيزوبوتيريل في Ustilaginoidea virens

(أ) خمسة وسبعون بروتينات مرتبطة بالريبوسوم. (ب) اثني عشر بروتينًا مرتبطًا بمسار بروتين كيناز (MAPK) المُنشط بالميتوجين. (ج) ثمانية بروتينات مرتبطة بعوامل بدء الترجمة. (د) أربعة بروتينات مرتبطة بالسبتينات. (ه) عشرة بروتينات مرتبطة بالالتهام الذاتي.

مطلوب UvRpd3 لإزالة K.hib في المختبر و في الجسم الحي، وفوعة يو فيرينز

ال S. cerevisiae تم الإبلاغ سابقًا عن أن هيستون ديستيلازز Rpd3p و Hos3p لها نشاط دي 2-هيدروكسي أيزوبوتيريل (Huang et al. ، 2017). كشفت محاذاة تسلسل الأحماض الأمينية عن UvRpd3 و UvHos3 ليكونا أخصائيي تقويم العظام S. cerevisiae Rpd3p و Hos3p مع هوية عالية (75٪ و 64٪ على التوالي). تحتوي جميعها على نفس المجال ، Hist_deacetyl ، وكانت تسلسلات البروتين في منطقة المجال المشترك متشابهة للغاية (الشكل S4A-C). للتحقق مما إذا كان Rpd3p و Hos3p متماثلان في يو فيرينز يمكن أن تنظم K.hib، خرجنا UvRpd3 و UvHos3 في U. virens (الشكل S5A ، B) وتحليل UvRpd3 و UvHos3 مسوخ الحذف (∆UvRpd3 و ∆UvHos3، على التوالي) عن طريق اللطخات المناعية باستخدام مضادات Khib الأجسام المضادة. في UvHos3 مسوخ الحذف ، لا تغيير في K.hib تم الكشف عن مستويات بين مسوخ الحذف وسلالة من النوع البري (الشكل 5 أ). ومع ذلك ، في UvRpd3 طفرات الحذف التي لاحظناها زيادات في K.hib وكأ على مستويات من النوع البري (الشكل 5 أ ، ب). لمزيد من استكشاف هذه النتيجة ، عبرنا UvRpd3 أو UvHos3 في الإشريكية القولونية وحصلوا على بروتينات UvRpd3 و UvHos3 المنقى. في في المختبر تجارب النشاط الأنزيمي ، كhib انخفضت المستويات في العديد من نطاقات البروتين في علاج Rpd3-GST (الجلوتاثيون- S- ترانسفيراز) ، في حين أن Khib لم تتغير المستويات في معالجة Hos3-GST (الشكل 5C) ، مما يشير إلى أن UvRpd3 يعمل كإنزيم إزالة التعديل لإزالة 2-hydroxyisobutyrylation. للتحقيق في ما إذا كان UvRpd3 وظائف في U. virens العدوى ، أجرينا فحوصات الفوعة باستخدام UvRpd3 طفرات الحذف على سيرة الأرز الحساسة. وانشيان -98. بعد 21 نقطة في البوصة ، مقارنة بالنوع البري وسلالة التكملة ، ∆UvRpd3 أنتجت المسوخ كرات تفحم كاذبة مخفضة بشكل كبير على السنيبلات (الشكل 5 د ، هـ). أظهرت هذه النتائج أن UvRpd3 مهم لـ K.hib إزالة وفوعة U. virens.

يحتوي UvRpd3 على نشاط de-2-hydroxyisobutyrylase

(أ) ليسين 2-هيدروكسي أيزوبوتيريل (K.hib) في المستويات UvRpd3 و UvHos3 تم الكشف عن طفرات الحذف والنوع البري (WT) عن طريق التكتل المناعي. يتم عرض نسختين مكررتين لكل طعنة مناعية باستخدام عموم مضاد Khib الأجسام المضادة. (ب) كأ المستويات في UvRpd3 تم الكشف عن متحولة الحذف و WT عن طريق التجلط المناعي. يتم عرض نسختين مكررتين لكل طعنة مناعية باستخدام عموم مضاد Kأ الأجسام المضادة. (ج) في المختبر يسين دي -2 هيدروكسي أيزوبوتيريل (K.hib) نشاط UvRpd3 و UvHos3 عن طريق فحوصات النشاف الغربية. يتم عرض نسختين مكررتين لكل طعنة مناعية باستخدام عموم مضاد Khib الأجسام المضادة. (د) ضراوة WT ، UvRpd3 طفرات الحذف ، وسلالة التكملة في 21 د بعد الإصابة على سيرة الأرز. وانشيان -98. (ه) متوسط ​​عدد كرات التفحم لكل عنقود. تم جمع البيانات من ثلاث تجارب مستقلة لكل علاج وتحليلها بواسطة اختبار فيشر للفرق الأقل أهمية (LSD). تمثل العلامات النجمية اختلافات كبيرة بين المسوخ و WT بواسطة LSD في ص = 0.05.

تسبب تحور مواقع 2-hydroxyisobutyrylation في MAPK UvSlt2 في تقليل الفوعة الفطرية والنشاط الأنزيمي لـ UvSlt2

في الكائنات حقيقية النواة ، يتوسط مسار إشارات MAPK الاستجابات للإشارات الفسيولوجية والبيئية. في مسببات الأمراض الفطرية الخيطية ، حافظت مسارات Pmk1-MAPK و Slt2-MAPK على وظائف في التسبب في المرض ، بينما يلعب مسار Hog1-MAPK دورًا خاصًا بالأنواع في التسبب في المرض. لمزيد من استكشاف دور البروتينات 2-hydroxyisobutyrylation في فوعة الفطريات المسببة للأمراض النباتية ، أجرينا الطفرات الموجهة بالموقع لمواقع 2-hydroxyisobutyrylation على UvSlt2 ، والذي تم تحديده كبروتين مفترض 2-hydroxyisobutyrylated. حددنا موقعين 2-hydroxyisobutyrylation على UvSlt2 ، الموجودان في K53 و K60 (الأشكال 6A ، B ، S6).للتحقق من صحة هذه المواقع ، تم إنشاء طفرات نقطة UvSlt2 UvSlt2 K53R و UvSlt2 K60R و UvSlt2 K53R / K60R ، حيث تم تحوير ليسينات مواقع 2-hydroxyisobutyrylation إلى أرجينين (K-R). النوع البري يوفسلت 2 و K-R تحور يوفسلت 2 تم دمج التركيبات مع جين البروتين الفلوري الأخضر (GFP) وتم التعبير عنها في ∆UvSlt2-2 متحولة. أكد النشاف الغربي للجزء المخصب بـ 2-hydroxyisobutyrylation أن 2-hydroxyisobutyrylation of UvSlt2 قد تعطل بشكل خطير بسبب هذه الطفرات ، لكن الطفرات النقطية لـ UvSlt2 لم تؤثر على مستوى تعديل الأستلة الخاص بها (الشكل 6C) ، مما يؤكد أن UvSlt2 هو بالفعل 2 - بروتين هيدروكسي أيزوبوتيريل المعدل في هذه المواقع.

UvSlt2 هو بروتين 2-هيدروكسي أيزوبوتيريل

(أ, ب) طيف طيف الكتلة الترادفي في الجسم الحي يسين 2-هيدروكسي أيزوبوتيريل (K.hib) مواقع UvSlt2. (ج) ال K.hib وكأ تم تحديد مستويات المؤتلف المنقى UvSlt2-GFP و UvSlt2 K53R -GFP و UvSlt2 K60R -GFP و UvSlt2 K53R / K60R -GFP بواسطة النشاف الغربي باستخدام pan anti-Khib ومكافحة Kأ الأجسام المضادة. تم قياس نطاقات إشارات البروتين باستخدام برنامج ImageJ (v1.6.0_24). (د) كشف النشاف الغربي أن UvRpd3 يمكنه تحفيز de-2-hydroxyisobutyrylation و deacetylation لـ UvSlt2. (ه) مقايسة الترسيب المناعي المشترك. تم سحب اللطخة الغربية للبروتينات والبروتينات الكلية باستخدام agarose المضاد للعلم من المحولات التي تشارك في التعبير عن تركيبات UvSlt2-GFP و UvRpd3-Flag أو بنية واحدة تم اكتشافها باستخدام الأجسام المضادة متعددة النسيلة المضادة لـ GFP والأجسام المضادة للعلم. (F) الفوعة من النوع البري (WT) ، يوفسلت 2 طفرات الحذف ، وسلالة التكميل ، والطفرات النقطية UvSlt2 K53R ، و UvSlt2 K60R ، و UvSlt2 K53R / K60R في 21 يومًا بعد الإصابة على سيرة الأرز. وانشيان -98. (جي) متوسط ​​عدد كرات التفحم لكل عنقود من النباتات في (F). (ح) أثر 2-hydroxyisobutyrylation لـ K53 و K60 على النشاط الأنزيمي لـ UvSlt2. الكشف عن نشاط سلالات WT و UvSlt2-1 و UvSlt2 K53R -1 و UvSlt2 K60R -1 و UvSlt2 K53R / K60R -1. تم جمع البيانات من ثلاث تجارب مستقلة لكل علاج وتحليلها بواسطة اختبار فيشر للفرق الأقل أهمية (LSD). تمثل العلامات النجمية اختلافات كبيرة بين المسوخ و WT بواسطة LSD في ص = 0.05.

لاختبار ما إذا كان UvRpd3 يمكنه إزالة الأسيتيل و 2-هيدروكسي أيزوبوتيريل من UvSlt2 ، أجرينا في المختبر تجارب على UvSlt2 المنقى. لاحظنا أن UvRpd3 يمكن أن يزيل كل من الأسيتيل و 2-hydroxyisobutyrylation من UvSlt2 (الشكل 6D). علاوة على ذلك ، أكد اختبار الترسيب المناعي المشترك (Co-IP) أن UvRpd3 تفاعل مع UvSlt2 (الشكل 6E). تشير هذه النتائج إلى أن UvRpd3 يتفاعل مع UvSlt2 لإزالة 2-hydroxyisobutyrylation و acetylation لـ UvSlt2.

لدراسة تأثير 2-hydroxyisobutyrylation على الوظائف البيولوجية لـ UvSlt2 ، قمنا بمقارنة الفوعة بين U. virens النوع البري، يوفسلت 2 مسوخ الحذف (Δيوفسلت 2-1 و ΔUvSlt2-2) ، سلالة التكملة (CΔUvSlt2-2) ، وسلالة UvSlt2-GFP (UvSlt2-1) ، وسلالات طفرة النقطة المفردة (UvSlt2 K53R -1 ، UvSlt2 K53R -2 ، UvSlt2 K60R -1 ، و UvSlt2 K60R -2) ، وسلالات طفرة النقطة المزدوجة (UvSlt2 K53R / K60R -1 و UvSlt2 K53R / K60R -2). أظهرت جميع سلالات UvSlt2 2-hydroxyisobutyrylation- التي تعاني من نقص (K-R) ضراوة أقل مقارنةً بسلالات النوع البري و UvSlt2-1 (الشكل 6F ، G). علاوة على ذلك ، كانت سلالات UvSlt2 2-hydroxyisobutyrylation التي تعاني من نقص (K-R) معيبة جزئيًا في الكونيدة ، ولكن ليس في النمو الفطري (الشكل S7). لتحديد سبب تأثير 2-hydroxyisobutyrylation لـ UvSlt2 على ضراوة U. virens، قمنا بقياس النشاط الإنزيمي لبروتينات UvSlt2 المتحولة على K-R. أظهرت جميع البروتينات المتحولة UvSlt2 K-R انخفاضًا ملحوظًا في النشاط الأنزيمي (الشكل 6H) ، مما يعني أن Khib يعدل النشاط الأنزيمي لـ UvSlt2. لذلك ، يمكن التحكم في وظائف UvSlt2 عن طريق 2-hydroxyisobutyrylation من خلال التنظيم الذاتي لنشاطه الأنزيمي.

محاكاة الديناميكيات الجزيئية لـ UvSlt2

لاكتساب نظرة ثاقبة للآليات المحتملة التي يمكن من خلالها أن يؤثر 2-hydroxyisobutyrylation على النشاط الأنزيمي UvSlt2 ، استخدمنا محاكاة الديناميكيات الجزيئية (MD) لتحديد كيفية تأثير 2-hydroxyisobutyrylation لـ K53 و K60 على بنية UvSlt2. عندما تم تحور بقايا اللايسين في الموضعين 53 و 60 إلى R ، كانت هياكل البروتين تقريبًا مماثلة لهيكل UvSlt2 غير المعدل (الشكل 7A-D). عمليات محاكاة MD لـ 2-hydroxyisobutyrylated UvSlt2 (K53hib، K60hib، K53hib/ K60hib) أشار إلى أن 2-hydroxyisobutyrylation لـ K53 و K60 نتج عنه هياكل كانت متطابقة تقريبًا مع UvSlt2 غير المعدل (الشكل 7E-G). هياكل 2-hydroxyisobutyrylated UvSlt2 (K53hib، K60hib، K53hib/ K60hib) والطفرات K-R UvSlt2 (K53R و K60R و K53R / K60R) كانت متطابقة تقريبًا مع UvSlt2 غير المعدل أثناء دورة المحاكاة بأكملها (الشكل 7H ، I). كشفت عمليات المحاكاة أن المسوخ و UvSlt2 غير المعدل يشتركان في هياكل ثانوية مماثلة وخضعت لتغييرات طفيفة فقط من البداية إلى الحالة النهائية. ومع ذلك ، فإن الهياكل الثانوية لـ 2-hydroxyisobutyrylated UvSlt2 (K53hib، K60hib، K53hib/ K60hib) كانت مختلفة بشكل ملحوظ عن تلك الخاصة بـ UvSlt2 غير المعدل (الشكل 7J). بسبب اضطراب الهياكل الثانوية والتقلبات التوافقية ، فإن هياكل 2-hydroxyisobutyrylated UvSlt2 لديها ميل قوي لتشكيل مساحة سطح يمكن الوصول إليها من مذيب مسعور (الشكل 7K ، L). عندما تم تحور K إلى R ، لم تتغير مساحة السطح التي يمكن الوصول إليها بواسطة المذيبات الكارهة للماء. الأهم من ذلك ، بعد UvSlt2 2-hydroxyisobutyrylation ، زادت مساحة السطح التي يمكن الوصول إليها من المذيبات الكارهة للماء ، وبالتالي أثرت على الارتباط بين إنزيم UvSlt2 وركائزه.

النمذجة الهيكلية لـ UvSlt2

(أ) الهيكل النهائي لمحاكاة UvSlt2 non-2-hydroxyisobutyrylated. (ب) الهيكل النهائي لمحاكاة UvSlt2 K53R. (ج) الهيكل النهائي لمحاكاة UvSlt2 K60R. (د) الهيكل النهائي لمحاكاة UvSlt2 K53R / K60R. (ه) الهيكل النهائي لمحاكاة UvSlt2 2-hydroxyisobutyrylated عند K53. (F) الهيكل النهائي لمحاكاة UvSlt2 2-hydroxyisobutyrylated عند K60. (جي) الهيكل النهائي لمحاكاة UvSlt2 2-hydroxyisobutyrylated عند K53 و K60. (ح, أنا) تحليل جذر متوسط ​​التربيع الانحرافات (RMSDs) ، وتقلبات الجذر التربيعي (RMSFs) ، ونصف قطر الدوران (Rgs) لأنظمة UvSlt2 المختلفة. (أعلى) مسارات RMSDs الإجمالية لأنظمة UvSlt2 المختلفة. (الأوسط) نصف قطر لمحات الدوران لأنظمة UvSlt2 المختلفة. (أسفل) ملفات تعريف RMSF الخاصة بالبقايا لأنظمة UvSlt2 المختلفة. (ي) تطور البنية الثانوية لـ UvSlt2 وطفراته. تمت مراقبة التطور في البنية الثانوية في كل إطار باستخدام قاموس خوارزمية البنية الثانوية للبروتين (DSSP). في الشرائط ، يمثل كل بكسل الهيكل الثانوي (المرمز بالألوان) لبقايا (40-70 ، x-البعد) في وقت معين في المحاكاة (ذ-البعد). (ك, إل) التطور الزمني لمنطقة السطح التي يمكن الوصول إليها بواسطة المذيبات (SAS) المحسوبة للأنظمة المختلفة التي تمت محاكاتها.


البروتوكولات

من السهل اتباع إرشادات البروتوكول الخاصة بالأجسام المضادة لـ Proteintech.

بروتوكولات خاصة بالمنتج

بروتوكولات خاصة بالمنتج مباشرة من دفتر المختبر الخاص بنا إلى جهازك.

يمكنك الآن العثور على البروتوكولات التفصيلية المصممة للأجسام المضادة الفردية في كتالوج Proteintech. تم تحسين البروتوكولات بشكل فردي لكل جسم مضاد لمساعدتك في تحقيق أفضل النتائج الممكنة.

كيفية الوصول إلى البروتوكولات الخاصة بالمنتج

انتقل إلى قائمة الدعم وانقر فوق "البروتوكولات الخاصة بالمنتج"

ابحث عن الجسم المضاد الذي اخترته بالاسم أو رقم الكتالوج في شريط بحث Proteintech.

حدد "عرض" بجوار الجسم المضاد الذي اخترته.

اختر بروتوكول PDF الخاص بالمنتج من بين مجموعة من تطبيقات الأجسام المضادة.

بدلاً من ذلك ، يمكنك العثور على بروتوكولات خاصة بالمنتج في علامة التبويب "البروتوكولات" في كل صفحة من صفحات منتجات الجسم المضاد.

إليسا

مقدمة إليسا

يستخدم اختبار الامتصاص المناعي المرتبط بالإنزيم (ELISA) على نطاق واسع في علم المناعة للكشف عن وجود البروتينات أو الأجسام المضادة الأخرى في العينة. على سبيل المثال ، يتم استخدامه كأداة أولية للكشف عن فيروس نقص المناعة البشرية ، بناءً على تفاعل الجسم المضاد مع المستضد الذي يقدمه الفيروس. هناك العديد من طرق ELISA المختلفة: تعد ELISA غير المباشرة ، و sandwich ELISA و ELISA التنافسي هي الأكثر استخدامًا. جميع الطرق الثلاث لها خطوات متشابهة:

1) إرفاق المستضدات أو الأجسام المضادة الأولية أو معقداتها على سطح صلب.

2) اغسل المواد غير المربوطة.

3) حجب المواقع المكشوفة على السطح الصلب.

4) إضافة الأجسام المضادة للكشف و / أو الأجسام المضادة الثانوية المرتبطة بالإنزيم.

5) تطوير اللون عن طريق إضافة ركائز تتفاعل مع الإنزيمات.

التحميلات

بروتوكول ELISA غير المباشر القابل للتنزيل بتنسيق PDF

أساسيات ELISA وعرض الشرائح النصائح الفنية

الكيمياء المناعية

مقدمة الكيمياء الهيستولوجية المناعية

تسمح لك الكيمياء الهيستولوجية المناعية (IHC) بتصور البروتينات في الأنسجة مع الحفاظ على بنيتها المجهرية. يساعد على توضيح الموضع الدقيق وتوزيع البروتين المطلوب في قسم الأنسجة التي تم تحليلها. ميزة هذا التصور هو أنه يسمح للمقارنة ، على سبيل المثال ، بين الأنسجة السليمة والمريضة. باختصار ، في تجربة IHC ، يتم تحديد المستضد المعني عن طريق ارتباط الجسم المضاد. يتم بعد ذلك تصور تفاعل الجسم المضاد مع المستضد من خلال الكشف عن الكروموجينيك أو الفلورسنت.

يحتوي بروتوكول IHC على العديد من الخطوات التي قد تتطلب التحسين لضمان ارتباط الجسم المضاد المحدد والتصور الأمثل للبروتين المستهدف. نظرًا لأن بروتوكول IHC يحتوي على العديد من العوامل المتغيرة المختلفة ، فقد يكون من الصعب العثور على أفضل ظروف العمل للحصول على تلطيخ قوي ومحدد.

بروتوكول IHC خطوة بخطوة
الكيمياء الهيستولوجية المناعية باستخدام أقسام البارافين المركبة على الشرائح

يتم تنفيذ جميع الخطوات الواردة في البروتوكول التالي في درجة حرارة الغرفة ما لم ينص على خلاف ذلك. يتم تضمين وصفات لجميع الحلول المميزة بالخط العريض في نهاية البروتوكول.

اغمر الشرائح في زيلين لمدة 10 دقائق. كرر هذه الخطوة مرة أخرى في زيلين طازج لمدة 10 دقائق. (إذا لزم الأمر ، كرر مرة ثالثة في زيلين جديد لمدة 10 دقائق أخرى.)

إعادة ترطيب المقاطع عن طريق الحضانة بالتتابع مع إيثانول 100٪ و 95٪ و 80٪ و 60٪ لمدة 5 دقائق لكل منهما.

اشطف المقاطع بالماء المقطر ثلاث مرات لمدة 3 دقائق لكل مقطع.

انقل الشرائح إلى وعاء آمن للاستخدام في الميكروويف وقم بتغطيته بغطاء السيترات العازلة أو المخزن المؤقت Tris-EDTA (TE).

سخنيها في الميكروويف على طاقة متوسطة لمدة 10 دقائق.

السماح للشرائح لتبرد في المخزن المؤقت للسيترات أو المخزن المؤقت Tris-EDTA (TE) لمدة 35 دقيقة تقريبًا.

اشطف الشرائح ثلاث مرات بمعدل 1x تبست لمدة 3 دقائق لكل منهما.

احتضان الشرائح بمحلول 3٪ H2O2 (مخفف في الماء المقطر) لمدة 10 دقائق لإخماد نشاط البيروكسيداز الداخلي.

اشطف الشرائح ثلاث مرات باستخدام 1x TBST لمدة 3 دقائق ، ثم اشطف الشرائح ثلاث مرات بالماء المقطر لمدة 3 دقائق لكل منها.

تحضير 5٪ من مصل الحجب الطبيعي في 1x TBST. يجب أن يُشتق المصل من نفس النوع الذي نشأ فيه الجسم المضاد الثانوي. كتلة المقاطع لمدة 1 ساعة. (بدلاً من ذلك ، استخدم 5٪ BSA في 1x TBST للحظر إذا كان المصل المقابل غير متوفر.)

احتضان المقاطع مع الجسم المضاد الأولي المخفف في 1x TBST لمدة 1 ساعة ، أو بين عشية وضحاها عند 4 درجات مئوية يجب أن تكون نسبة التخفيف المثلى للجسم المضاد محددة مسبقًا بالتجربة. قم بإعداد عناصر التحكم السلبية عن طريق حذف خطوة حضانة الجسم المضاد الأولية لشريحة واحدة لكل حالة تجريبية.

بعد شرائح الحضانة الأولية للجسم المضاد ثلاث مرات مع 1x TBST لمدة 3 دقائق لكل منهما.

ضع كمية كافية من البيروكسيديز المسمى البوليمر واحتضانها لمدة 30 دقيقة.

اشطف الشرائح ثلاث مرات باستخدام 1x TBST لمدة 3 دقائق لكل منها.

قم بإعداد حجم مناسب من محلول الركيزة قبل الاستخدام عن طريق خلط قطرة واحدة من السائل DAB بالإضافة إلى الكروموجين على الفور مع 1 مل من محلول الركيزة.

ضع الركيزة بعناية واحتضنها لمدة 5-10 دقائق حتى يتحول لونها إلى اللون البني.

شطف المقاطع برفق بماء مقطر كافٍ.

لتلطيخ النوى ، اغمر الشرائح في حمام من الهيماتوكسيلين لمدة 3 دقائق.

شطف الشرائح برفق بالماء المقطر.

نقل الشرائح إلى محلول إيثانول 1٪ حمض الهيدروكلوريك ، 99٪ لمدة 10 ثوان نقل إلى الماء المقطر على الفور

تزج الشرائح بالتتابع في حمامات الإيثانول 60٪ و 80٪ و 95٪ و 100٪ لمدة 5 دقائق لكل منهما.

اغمر الشرائح في زيلين لمدة 5 دقائق. كرر هذه الخطوة مرة أخرى في زيلين طازج لمدة 5 دقائق.

قم بتركيب القسم بوسائط تركيب كافية وغطاء بغطاء.

يجف في الهواء في منطقة جيدة التهوية (مثل غطاء الدخان).

حلول

التحميلات

كيفية تحسين تجربة الكيمياء المناعية الخاصة بك - الدليل الكامل

المدينة العالمية للخدمات الإنسانية (IHC) باستخدام أقسام البارافين المثبتة على الشرائح بروتوكول PDF القابل للتنزيل

IHC: القسم المجمد مقابل قسم البارافين بروتوكول PDF القابل للتنزيل

تألق مناعي

مقدمة المناعي

التلوين المناعي (IF) هو تقنية مستخدمة على نطاق واسع في البحث البيولوجي والتشخيص السريري. يستخدم IF الأجسام المضادة التي تحمل علامات الفلورسنت للكشف عن مستضدات مستهدفة محددة. متبوعة بالتصوير ، إنها تقنية مباشرة للغاية حيث يمكنك تصور النتائج. على الرغم من أنها أداة راسخة ، إلا أنه يجب مراعاة عوامل متعددة ويجب اتخاذ خطوات تحسين مختلفة لضمان تلطيخ ناجح.

خطوة بخطوة إذا بروتوكول
الخلايا المستنبتة المناعية

يتم تنفيذ جميع الخطوات الواردة في هذا البروتوكول في درجة حرارة الغرفة ما لم يذكر خلاف ذلك. للحصول على تلطيخ مثالي ، يجب إجراء الحضانات على شاكر دوار بطيء الحركة ما لم يكن خط الخلية المستخدم دقيقًا (مثل الخلايا العصبية). يتم توفير وصفات للحلول المميزة بالخط العريض باتباع البروتوكول.

وسط نضح ، يغسل الخلايا المصنفة على غطاء زجاجي نظيف ينزلق لفترة وجيزة 1X برنامج تلفزيوني.

إصلاح الخلايا مع 4٪ بارافورمالدهيد طازجة في 1X PBS لمدة 10 دقائق.

شطف الغطاء ينزلق بـ 1X PBS 3 مرات لمدة 3 دقائق لكل منهما.

يتخلل مع 0.2٪ Triton X-100 المصنوع في 1X PBS لمدة 5 دقائق. ينزلق غطاء الشطف 3 مرات مع 1X PBS لمدة 3 دقائق لكل منهما.

نضح محلول الحجب وقم بتطبيق الجسم المضاد الأولي المخفف في عازلة تخفيف الجسم المضاد. نضع جانبا حالة تجريبية واحدة للنعال من أجل التحكم السلبي واحتضانها في المخزن المؤقت لتخفيف الأجسام المضادة مطروحًا منه الجسم المضاد الأساسي. اترك هذه الحضانات لمدة ساعة واحدة ، أو بدلاً من ذلك ، احتضانها طوال الليل عند 4 درجات مئوية.

يرجى ملاحظة: في حالة الحضانة بين عشية وضحاها ، اتخذ التدابير اللازمة لضمان عدم جفاف زلات الغطاء.

يغسل الغطاء مع 1X PBS 3 مرات لمدة 3 دقائق لكل منهما.

تطبيق مناسب مضاد ثانوي مترافق بالفلوروفور مخفف في المخزن المؤقت لتخفيف الأجسام المضادة إلى الأغطية واحتضان لمدة 1 ساعة في بيئة رطبة ومظلمة.

يرجى ملاحظة: من الضروري الاحتفاظ بزلات الغطاء في الظروف المظلمة قدر الإمكان بعد إضافة الكواشف الفلورية.

يغسل الغطاء مع 1X PBS 3 مرات لمدة 3 دقائق لكل منهما.

ينزلق غطاء التركيب على شرائح المجهر باستخدام Hydromount (التشخيصات الوطنية) التي تحتوي على DAPI (إذا رغبت في ذلك) للتلوين النووي.

افحص الشرائح تحت مجهر مضان.

حلول
1X برنامج تلفزيوني في 1000 مل (الحجم النهائي)
10 ملم ناحبو 1.42 جرام
1.8 ملي KH₂PO₄ 0.24 جرام
137 ملي كلوريد الصوديوم 8 جرام
2.7 ملي بوكل 0.2 غ
ضبط على الرقم الهيدروجيني 7.4
أضف ddH₂O إلى 1000 مل
عازلة تخفيف الجسم المضاد في 20 مل (الحجم النهائي)
1٪ جيش صرب البوسنة 0.2 جرام
أضف 1X PBS إلى 20 مل

التحميلات

الدليل الكامل لتحسين البروتوكولات العامة لتلوين التألق المناعي ، والنصائح الفنية والأسئلة الشائعة

الخلايا المستنبتة المناعية للتحميل PDF

الترسيب المناعي

مقدمة الترسيب المناعي

الترسيب المناعي (IP) هو تقنية تنقية تقارب. يقوم IP بتنقية مستضد باستخدام جسم مضاد محدد مثبت في مصفوفة صلبة. IP هي واحدة من أكثر الطرق شيوعًا لعزل البروتينات خارج الخلية أو محلولات الأنسجة.

بروتوكول IP خطوة بخطوة

احتفظ بالعينات باردة قدر الإمكان عن طريق تنفيذ الخطوات أدناه على الجليد أو في غرفة باردة 4 درجات مئوية. يتم تضمين وصفات لجميع الحلول المميزة بالخط العريض في نهاية البروتوكول.

  • قد يتم تفكيك الخلايا باستخدام أي بروتوكول قياسي لتحليل الخلايا متوافق مع مادة البداية الخاصة بك. راجع "تحضير محلول الخلايا والأنسجة" للحصول على بروتوكولات التحلل الموصى بها من Proteintech.

نصيحة 1: تركيزات عالية من المنظفات تتداخل مع الترسيب المناعي (IP). خلايا ليس ذات حجم صغير من المخزن المؤقت لتحلل RIPA قدر الإمكان قبل تخفيف lysates مع 1x PBS إلى الحجم النهائي المطلوب.

نصيحة 2: استخدم محلولًا كافيًا: لكل IP هدف لاستخدام ما بين 1-3 مجم بروتين إجمالي. تعتبر Lysates من 0.2-0.5 مل ، تحتوي على إجمالي 1-3 ملغ بروتين ، مناسبة بشكل مثالي لبروتين IP واحد. قم بقياس إجمالي كمية البروتين بمقايسة البروتين ، مثل برادفورد أو اختبار BCA.

النصيحة 3: تأكد من وجود مثبطات الأنزيم البروتيني في المخزن المؤقت المحللة. يجب أن يكون تركيز مثبط البروتياز 1.5-2 مرة من بروتوكول تحضير المحللة النموذجية للنشاف الغربي.

  • إعادة تعليق ملاط ​​حبة البروتين A أو G sepharose عن طريق دوامة زجاجة التخزين بلطف. أضف بسرعة 50 ميكرولتر من ملاط ​​الحبيبات بنسبة 50٪ لكل 0.5 - 1 مجم من البروتين الكلي إلى أنبوب الميكروفوج الذي يحتوي على محلولتك.

نصيحة 4: قطع نهاية طرف الماصة بعناية بزاوية 45 درجة باستخدام نصل حاد لتسهيل الماصات في ملاط ​​حبة. للحفاظ على الشفط ، لا يلزم إزالة سوى جزء صغير جدًا من طرف الماصة.

  • احتضان على خلاط دوار لمدة 30 دقيقة عند 4 درجات مئوية.
  • الطرد المركزي عند 1000 دورة في الدقيقة لمدة 3 دقائق عند 4 درجات مئوية ونقل المادة طافية إلى أنبوب جديد

نصيحة 5: يُنصح بالتنقية المسبقة باستخدام خرزات البروتين A أو G sepharose للأنسجة الوفيرة في IgG.

أضف كمية مناسبة (1-4 ميكروغرام) من الجسم المضاد الأولي إلى المحللة الكاملة (أو التي تم مسحها مسبقًا). يجب تحديد تركيز الجسم المضاد الأمثل عن طريق المعايرة. قم بإعداد تجربة تحكم سلبية مع تحكم IgG (المقابل لمصدر الجسم المضاد الأساسي). هز الحضانات برفق عند 4 درجات مئوية لمدة 2-4 ساعات أو بين عشية وضحاها.

إضافة 50 ميكرولتر من البروتين A أو G ملاط ​​حبة سيفروز لالتقاط المركب المناعي. هز الخليط برفق عند 4 درجات مئوية لمدة 1-4 ساعات.

الطرد المركزي خليط IP عند 1000 دورة في الدقيقة لمدة 30 ثانية عند 4 درجات مئوية وتجاهل المادة طافية.

اغسل الخرز 3-4 مرات مع 1 مل 1x TBST مع مثبط البروتياز 1x ، وأجهزة الطرد المركزي وتجاهل المادة طافية كما في الخطوة 6. احتفظ بحوالي 80 ميكرولتر طاف بعد آخر جهاز طرد مركزي.

أعد تركيب الحبيبات بـ 20 مايكرولتر 5x المخزن المؤقت لعينة SDS، دوامة برفق لعدة ثوان.تسخين عند 95-100 درجة مئوية لمدة 5 دقائق وطرد مركزي عند 10000 جم × جم (حوالي 9700 دورة في الدقيقة للدوارات التي يبلغ نصف قطرها 9.5 سم) لمدة 3 دقائق.

قم بتحميل المواد الطافية على هلام SDS-PAGE ، أو بدلاً من ذلك ، قم بنقل المادة الطافية بعناية إلى أنبوب microfuge الجديد المسمى جيدًا وتخزينها عند -80 درجة مئوية لاستخدامها لاحقًا. (بالنسبة للطريقة الثانية ، قم بالتخزين مباشرة في درجة حرارة -80 درجة مئوية لاستخدامها لاحقًا).

افصل IPs بواسطة SDS-PAGE وانقل البروتينات إلى غشاء PVDF. دقق مع الأجسام المضادة المناسبة.

نصيحة 6: للكشف عن البروتينات المثبطة للمناعة عن طريق النشاف الغربي ، بدون أو تقليل الكشف عن الآثار غير المحددة (مثل السلاسل الثقيلة والخفيفة للجسم المضاد المناعي) ، اكتشف الأجسام المضادة الأولية باستخدام جسم مضاد لسلسلة خفيفة (L) مضاد للأرانب مترافق مع HRP والبروتين A المترافق مع HRP بدلاً من الأجسام المضادة الثانوية التقليدية المرتبطة بـ HRP. (البروتين A لديه تقارب أعلى للأجسام المضادة السليمة مقارنة بالأجسام المضادة المشوهة).


ساهم هؤلاء المؤلفون بالتساوي: كلفن إف تشو ، تيس سي برانون.

الانتماءات

برنامج بيولوجيا السرطان ، جامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية

قسم علم الوراثة ، جامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية

كلفن إف تشو وأليس واي تينغ

قسم البيولوجيا الجزيئية والخلوية ، جامعة كاليفورنيا ، بيركلي ، بيركلي ، كاليفورنيا ، الولايات المتحدة الأمريكية

معهد برود في معهد ماساتشوستس للتكنولوجيا وجامعة هارفارد ، كامبريدج ، ماساتشوستس ، الولايات المتحدة الأمريكية

نامراتا د. أوديشي ، صموئيل أ. مايرز وأمبير ستيفن أ.كار

قسم الأحياء ، جامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية

قسم الكيمياء ، جامعة ستانفورد ، ستانفورد ، كاليفورنيا ، الولايات المتحدة الأمريكية

تشان زوكربيرج بيوهوب ، سان فرانسيسكو ، كاليفورنيا ، الولايات المتحدة الأمريكية

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

مساهمات

K.F.C.، T.C.B، N.D.U.، S.A.M.، S.A.C، and A.Y.T. ساهم في كتابة وتحرير المخطوطة.

المؤلف المراسل


مناقشة

1،25 (OH) 2D3 هو المنظم الرئيسي للتوازن Ca 2+ من خلال الارتباط بمستقبل محدد- VDR [38]. تشمل الأعضاء النموذجية المستهدفة لهذا الهرمون العظام والأمعاء والكلى. في الواقع ، تمتلك مجموعة متنوعة من الأنسجة التي لا تشارك في التمثيل الغذائي للمعادن والعظام VDR محددة وتستجيب بالتتابع لـ 1،25 (OH) 2D3 ، بما في ذلك الخصية [13]. ومع ذلك ، فإن دور 1،25 (OH) 2D3 في فسيولوجيا أعضاء الجهاز البولي التناسلي ، لا يزال غير معروف بشكل أساسي. في دراستنا ، كنا نهدف إلى التحقيق في الدور الوظيفي 1،25 (OH) 2D3 في فسيولوجيا الحيوانات المنوية والآليات الجزيئية التي قد يؤثر من خلالها هذا السيكوستيرويد على تكاثر الذكور البشريين ، واكتشاف إجراءات جديدة 1،25 (OH) 2D3.

أولاً ، حددنا VDR في الحيوانات المنوية على مستويات مختلفة: وجود mRNA ، وتعبير البروتين وتوطينه. أظهرت التقارير السابقة التي توضح حجم VDR بواسطة الرحلان الكهربائي للهلام ، أنه يختلف باختلاف الأنواع المدروسة بوزن جزيئي يتراوح من 50 إلى 60 كيلو دالتون. أظهرت الخصية البشرية وجود بروتين 57 وآخر بوزن جزيئي 52 كيلو دالتون مقارنة بـ 57 و 37 كيلو دالتون في خصية الفئران [39]. أظهر البروستات البشرية بروتين 52 كيلو دالتون مقارنة بالبروستات البطنية (57 و 37 كيلو دالتون) والبروستاتا الظهرية (52 و 26 كيلو دالتون). بياناتنا حول الأشكال الإسفنجية VDR غير قابلة للتغلب على تلك الموجودة في الخصية البشرية. في الآونة الأخيرة ، في الحيوانات المنوية البشرية ، تم الإبلاغ عن VDR بحجم 50 كيلو دالتون [14] ، وقد يكون هذا التناقض مع بياناتنا بسبب الأساليب المنهجية المختلفة و / أو إلى الجسم المضاد المستخدم. يبدو أنه يتم التعبير عن كمية أقل من VDR في العينات المرضية التي تحتوي على نقص شديد في النطاف. أكد توطين VDR عن طريق مقايسة التألق المناعي البيانات التي لوحظت في دراستنا السابقة ، والتي أظهرت من خلال التحليل المناعي أن VDR تم توطينه في نواة الحيوانات المنوية ، على الرغم من أن بعض الجسيمات زينت الرقبة أيضًا [15]. في الخلايا الجسدية ، يصبح مركب هرمون المستقبل موضعيًا للنواة ثم يتفاعل مع العنصر المستجيب 1،25 (OH) 2D3 ، مما يؤدي إلى تعديل نسخ الجينات المستهدفة. بالإضافة إلى عملها الجينومي الكلاسيكي ، تنظم المستقبلات النووية العمليات الخلوية من خلال آلية غير جينومية [40]. من المقبول عمومًا أن نواة الحيوانات المنوية غير نشطة نسبيًا بسبب البنية شديدة التكثيف لكروماتينها. في هذه الدراسة ، بحثنا في التأثيرات السريعة لـ VDR كما لاحظنا سابقًا بالنسبة للمستقبلات النووية الأخرى في الحيوانات المنوية البشرية [18 ، 29 ، 41]. في الواقع ، يبدو أن طريقة العمل هذه مناسبة بشكل خاص في الأمشاج الذكرية لأن وظائف الحيوانات المنوية تحتاج إلى التنشيط بسرعة لاستيعاب التغيرات الديناميكية في البيئة المحيطة. الأهم من ذلك ، أثبتت دراستنا أيضًا أن 1،25 (OH) 2D3 هو هرمون منتج محليًا لأن الأمشاج الذكرية تعبر عن 1α ، هيدروكسيلاز. إن وجود هذا البروتين في الحيوانات المنوية و VDR يزيد من احتمال حدوث حلقة قصيرة من الأوتوكرين.

يعتمد فسيولوجيا الحيوانات المنوية على الإشارات غير الذكرية التي يلعب فيها Ca2 + دورًا مهمًا [42 ، 43] ، ومع ذلك ، فإن تنظيمها غير مفهوم جيدًا. قادنا الإنتاج المستقل 1،25 (OH) 2D3 معًا وجود VDR إلى افتراض وجود تنظيم استبدادي لـ Ca2 + في الحيوانات المنوية ، على أساس هذا الدور الكلاسيكي 1،25 (OH) 2D3 على المستوى النظامي. هناك أدلة كثيرة على وجود مخازن Ca 2+ في الحيوانات المنوية للثدييات ، وقد ثبت مؤخرًا أنها تلعب دورًا مهمًا في تحفيز الحركة المفرطة النشاط. في الواقع ، يمكن أن توفر مخازن Ca 2+ الداخلية ما يكفي من Ca 2+ لتحريض فرط النشاط ، وبعد ذلك يكون تدفق Ca 2+ مطلوبًا للحفاظ على مستويات Ca 2+ داخل الخلايا كافية لتعظيم واستدامة هذه العملية التي أدت إلى تفاعل أكروسوم [36 ]. يتضح من بياناتنا أن 1،25 (OH) 2D3 ، من خلال VDR ، قادر على زيادة مستويات Ca 2+ داخل الخلايا ، مع معالجة دور المستقبل في تحريض الحركة المفرطة النشاط ، والتي بدورها تؤدي أو تساهم في تغييرات الحيوانات المنوية المرتبطة بالسعة والتفاعل الجسيمي. تخضع الآليات التي تتحكم في التفاعل بين توازن الطاقة والتكاثر لتحقيقات مكثفة. تُظهر الحيوانات المنوية المُكثَّفة زيادة في التمثيل الغذائي ونفقات الطاقة الإجمالية ، ومع ذلك ، فإن مسارات الإشارات المرتبطة بالتغير في طاقة استقلاب الحيوانات المنوية غير مفهومة جيدًا. في هذه الدراسة ، لاحظنا في الحيوانات المنوية أن 1،25 (OH) 2D3 ، من خلال VDR ، يقلل محتوى الدهون الثلاثية بالتزامن مع زيادة نشاط الليباز. تكمن خطوة تحديد المعدل في استقلاب الدهون المحايدة في الأنسجة الدهنية في مستوى الليباز ، الذي يحفز التحلل المائي للدهون الثلاثية [44] ، وقد تم إثبات نشاط الليباز المرتفع سابقًا في الحيوانات المنوية [45]. ومع ذلك ، فإن الركيزة الذاتية المستخدمة في استقلاب الطاقة بواسطة الحيوانات المنوية هي نوع محدد وإلى أي درجة توفر الدهون الثلاثية متطلبات الطاقة للحيوانات المنوية في الثدييات غير واضحة. على وجه الخصوص ، يبدو من دراستنا أن 1،25 (OH) 2D3 لا يؤثر على أنشطة أكسدة FFA أو G6PDH ويمكن تفسير ذلك من خلال حقيقة أن زيادة نشاط الليباز ينظمه Ca 2+ [46] وبالتالي ، قد يكون هذا التأثير منسوبًا إلى تأثير كلسي 1،25 (OH) 2D3.

المثير للاهتمام ، يبدو أن 1،25 (OH) 2D3 يؤثر بشكل مختلف على استقلاب الدهون في الخلايا الشحمية وفي الحيوانات المنوية. في الخلايا الشحمية البشرية ، يحفز 1،25 (OH) 2D3 تدفق الكالسيوم 2+ ، ويعزز تكوين الدهون ويمنع تحلل الدهون عن طريق عمل غير جينومي سريع [47]. لقد تم إثبات أن قمع 1،25 (OH) 2D3 بواسطة نظام غذائي عالي الكالسيوم 2+ يحفز تحلل الدهون ، ويمنع تكون الدهون [48] وبالتالي ينقل تقسيم الطاقة الغذائية من تخزين الطاقة إلى إنفاق الطاقة. وبالمثل ، قد يحدث هذا التأثير "المضاد للسمنة" لـ Ca 2+ في الحيوانات المنوية أثناء التكاثف عندما يزداد تدفق Ca 2+ بشدة. لذلك ، يبدو أنه على الرغم من الأنسجة الدهنية ، فإن 1،25 (OH) 2D3 له تأثير تحلل الدهون في الحيوانات المنوية ، ولكن قد يوجد تعاون معقد بين عوامل الغدد الصماء والأوتوكرين / الباراكرين في هذه الخلية مما يؤدي إلى تنظيم دقيق للطاقة اللازمة لمختلف الظروف الفسيولوجية. قد تكون الزيادة المبكرة في Ca 2+ الخالية من الحيوانات المنوية داخل الخلايا الناتجة عن 1،25 (OH) 2D3 متضمنة في تحويل عملية التمثيل الغذائي من تكوين الدهون إلى تحلل الدهون. في الواقع ، يمكن التكهن بأن 1،25 (OH) 2D3 يزيد من تعبئة Ca 2+ داخل الخلايا ، مما يحفز تحريض السعة التي تتطلب طاقة. لذلك يزيد التمثيل الغذائي للدهون لتلبية متطلبات الطاقة أثناء العملية عن طريق تقليل تخزين الطاقة وزيادة إنفاق الطاقة. إلى جانب ذلك ، قد يكون التمثيل الغذائي للدهون في الحيوانات المنوية أكثر حساسية لتغيرات الكالسيوم 2+ نظرًا لأهمية هذه الإشارة في الحيوانات المنوية. إنفاكت من المهم الإشارة إلى أن الكالسيوم 2+ داخل الخلايا يكون تقريبًا 50-100 نانومتر في الحيوانات المنوية غير المهيأة ، 200-1000 نانومتر في الحيوانات المنوية شديدة النشاط [49] وقد يزيد إلى حوالي 10 ميكرومتر أثناء تفاعل الجسيم [50].

تم الإبلاغ عن مجموعة واسعة من الاستجابات السريعة التي تم تحفيزها بواسطة 1،25 (OH) 2D3 [51]. تم إثبات مشاركة ERK1 / 2 و AKT و GSK3 في أنشطة الحيوانات المنوية المختلفة [18 ، 21]. في هذه الدراسة ، تحفز 1،25 (OH) 2D3 بسرعة كل هذه المسارات التي تشير إلى أن VDR متورط في وظائف الحيوانات المنوية المختلفة وبالتالي تأكيد الأهمية الفسيولوجية غير المتوقعة للهرمون في الأمشاج الذكرية البشرية.

يمكن أن يكون تركيز الهرمون حاسمًا في تحديد نوع استجابة الخلية. لوحظ في أنظمة الخلايا المختلفة أن مستوى الهرمون ينظم الارتباط بين المستقبلات المختلفة ومؤثرات الإشارة مما يشير إلى أن تجميع أو تفكيك الوحدات المختلفة متورط في التأثيرات التي تسببها تركيزات الهرمونات المنخفضة والعالية [52 ، 53]. في دراستنا ، يبدو أن الاستجابة لـ 1،25 (OH) 2D3 ثنائية الطور مع تأثير تحفيزي بتركيزات منخفضة ، وتصبح مثبطة أو غير فعالة في المستويات الأعلى. كما تم مؤخرًا إثبات نتيجة تنشيط الإشارات اعتمادًا على الاختلافات في مستوى الترابط في الحيوانات المنوية البشرية [15 ، 18 ، 21 ، 29 ، 41] ويعتمد التفسير المحتمل على التنظيم السفلي للمستقبلات عند ارتفاع تركيز الهرمون [54]. إن الملاحظة التي تشير إلى أن مستويات الهرمونات المختلفة تؤدي إلى استجابات مختلفة في خلايا الحيوانات المنوية هي مثال رائع على المرونة الواضحة لهذه الخلية في الاستجابة للستيرويدات.

في الختام ، قد يشارك المصدر المحلي للحيوانات المنوية لـ 1،25 (OH) 2D3 مع إجراءات مختلفة في النضج الوظيفي للحيوانات المنوية. تحدد البيانات التي قدمتها التجارب الحالية بوضوح الدور الجزيئي لـ VDR في فسيولوجيا الحيوانات المنوية ويمكن اعتبارها معدلاً جديدًا لقدرة تخصيب الحيوانات المنوية. VDR موجود في الأنابيب المنوية ، في الحيوانات المنوية [12] وفي الحيوانات المنوية [14 ، 15]. بالإضافة إلى هرمونات الستيرويد الجنسية ، وهي المنظمين الكلاسيكيين للتكاثر ، فإن فيتامين (د) ينظم أيضًا العمليات التناسلية في أنثى الإنسان. بعد ترسيب الحيوانات المنوية في المهبل عن طريق القذف ، يجب أن تنتقل عبر مخاط عنق الرحم إلى الرحم ثم إلى قناة فالوب قبل أن تتمكن من الالتقاء بالبويضة. يتم التعبير عن 1 alpha-hydroxylase في أنسجة عنق الرحم والرحم [55 ، 56]. تعبر الظهارة المهبلية [57] وخلايا عنق الرحم وبطانة الرحم [58] وخلايا فالوب الظهارية عن VDR [59 ، 12] مما يشير إلى الدور الفسيولوجي لـ 1،25 (OH) 2D3 في هذا السياق. تم الإبلاغ عن أن كمية 1،25 (OH) 2D3 الموجودة في السائل الجريبي أقل بكثير من المصل المتزامن [60]. قد تدعم هذه الملاحظات أيضًا نتائجنا المتعلقة بالتأثير ثنائي الطور لجرعات 1،25 (OH) 2D3 ، نظرًا لأن مستويات الهرمون المنخفضة تحفز غالبية أنشطة الحيوانات المنوية التي تم تقييمها ، بينما يبدو أن التركيزات الأعلى غير فعالة. ومع ذلك ، فإن الأهمية الفسيولوجية والدور المحدد لـ 1،25 (OH) 2D3 / VDR في كلا الأمشاج بحاجة إلى مزيد من التحقيق.

مجتمعة ، وسعت نتائجنا دور 1،25 (OH) 2D3 إلى ما وراء الإجراءات الفسيولوجية التقليدية ، وعززت معرفتنا بالحيوانات المنوية البشرية على المستوى الجزيئي وفهمنا لمسار إشارات فيتامين (د) ، مما مهد الطريق لفرص علاجية جديدة في علاج اضطرابات الخصوبة عند الذكور. قد يوفر تعديل VDR أيضًا آلية يمكن من خلالها لفيتامين D البيئي أو الغذائي أن يؤثر على قدرة الحيوانات المنوية على تخصيب وبالتالي على تكاثر الذكور.


المواد والطرق

إعداد RNA ، RNA Seq ، معالجة القراءة ، وتحليل البيانات

تم عزل مجموع الحمض النووي الريبي من تي. بروسي في مراحل مختلفة (1 × 10 8 خلايا / تكرار) باستخدام مجموعة miRNeasy (Qiagen ، ألمانيا) وفقًا لبروتوكول الشركة المصنعة. تم إجراء خطوة إضافية لهضم DNase1 لضمان عدم تلوث العينات بالحمض النووي الجيني. تم تقييم نقاء RNA باستخدام Agilent 2100 Bioanalyzer (Agilent Technologies ، سانتا كلارا ، كاليفورنيا). تم إجراء إعداد مكتبة تسلسل الجيل التالي (NGS) باستخدام مكتبة TruSeq-Specific mRNA Library مع PolyA-Selection باتباع بروتوكول Illuminas القياسي. تم تصنيف المكتبات باستخدام مجموعة DNA عالية الحساسية على محلل بيولوجي 2100 وتم قياسها باستخدام مجموعة Qubit dsDNA HS Assay Kit ، في Qubit 2.0 Fluorometer (تقنيات الحياة). تم ترتيب تسلسل المكتبات على Illumina NextSeq 500 في مرفق الجينوميات الأساسي في معهد البيولوجيا الجزيئية ، ماينز ، ألمانيا. أنتج قياس RNA-Seq في المتوسط ​​11.1 M قراءة فردية 75 nt لكل عينة. قمنا بتقييم جودة القراءات المتسلسلة باستخدام fastqc [72] و dupRadar (https://doi.org/10.1186/s12859-016-1276-2). تمت إزالة تسلسلات الزعيم المقسم (CAATATAGTACAGAAACTGTTCTAATAATAGCGTTAGTT) من القراءات باستخدام cutadapt (https://doi.org/10.14806/ej.17.1.200) ثم تعيينها إلى تي. بروسي 11 كروموسومات ذات قاعدة ميغا (TriTrypDB الإصدار 36) باستخدام STAR الإصدار 2.5.2b (https://doi.org/10.1093/bioinformatics/bts635) ، مما يسمح بحد أقصى 2 من حالات عدم التطابق ، والحد الأدنى لطول intron هو 21 ، مع الاحتفاظ بالقراءات المحاذاة بشكل فريد فقط ( في المتوسط ​​، 75.1٪ من جميع القراءات). قمنا بعد ذلك بحساب عدد القراءات لكل جين باستخدام featureCounts (https://doi.org/10.1093/bioinformatics/btt656) من إصدار الحزمة الفرعية 1.5.1 مع المعلمات الافتراضية واستخدام النماذج الجينية التي يوفرها TriTrypDB الإصدار 36. لتحليل التعبير التفاضلي ، استخدمنا الإصدار R 3.4.3 (http://www.R-project.org/) و DESeq2 الإصدار 1.18.1 (https://doi.org/10.1186/s13059-014-0550-8) للتطبيع ، تحويل ونمذجة البيانات. تم تركيب الأعداد على نموذج خطي معمم ذي الحدين السالب (GLM) ، واستخدم اختبار أهمية والد لتحديد الجينات المعبر عنها تفاضليًا بين عينات التحكم وعينات الضربة القاضية. أخيرًا ، تم حساب قيم RPKM لكل جين باستخدام قيم FPM التي تم ضبط حجمها للمكتبة (أعداد قوية لكل مليون جزء معين) من DESeq2. قمنا بتطبيق التصفية المستقلة التلقائية لتجنب اختبار الجينات ، والتي كانت مرشحة سيئة للتعبير التفاضلي (زيادة عدد ص القيم الأقل من alpha = 0.1). تم تحديد mRNAs المعبر عنها تفاضليًا باستخدام عتبة Benjamini-Hochberg المصححة ص القيم & lt0.05. تم إجراء تحليلات التخصيب GO باستخدام تعليقات GO Term التوضيحية TriTrypDB-36_TbruceiLister427_GO.gaf من TriTrypDB الإصدار 36 واختبار فيشر الدقيق. للمقارنة مع بيانات النسخ الخاصة بمجموعة البيانات المنشورة سابقًا للأشكال المعادية للحلقة والميتاسكليك من تي. بروسي [26،31] ، تم تنزيل ملفات البيانات الأولية RNA-Seq ذات الصلة من SRA (Bioproject PRJNA381952) ومعالجتها تمامًا كما هو موضح أعلاه لبياناتنا.

تحضير عينة مطياف الكتلة وقياس MS وتحليل بيانات البروتينات

تي. بروسي في مراحل مختلفة (1 × 10 8 خلايا / مكرر) تم غسلها ثلاث مرات في 10 مل من محلول ملحي مخزّن من الفوسفات (PBS) ومحلول في 6 ٪ كبريتات دوديسيل الصوديوم (SDS) ، 300 ملي مولار DTT ، و 150 ملي مولار تريس- حمض الهيدروكلوريك ( الرقم الهيدروجيني 6.8) ، 30٪ جلسرين ، 0.02٪ بروموفينول بلو. تم تحميل العينات على NOVEX NuPage 4٪ -12٪ gradient gel (Thermo Fisher Scientific، Waltham، MA) ، وتشغيلها لمدة 10 دقائق عند 180 فولت ، وملطخة بـ Coommassie G250. تم قطع كل ممر وتم نقل قطع الهلام المفرومة إلى أنبوب إيبندورف للتخلص منها باستخدام 50٪ إيثانول / 50 ملي مولار من محلول ABC المؤقت الأس الهيدروجيني 8.0. تم تجفيف قطع الهلام وتقليلها لاحقًا (10 ملي مولار من DTT / 50 ملي مولار ABC عازلة pH 8.0) ، ألكلة (55 ملي مولار يودواسيتاميد / 50 ملي مولار ABC عازلة 8.0) ، وهضمها مع 1 ميكروغرام من التربسين طوال الليل عند 37 درجة مئوية. تمت إزالة الببتيدات التريبتية من قطع الهلام باستخدام الأسيتونيتريل النقي وتخزينها على StageTip [73].

تم إجراء القياس البروتيني على مطياف الكتلة Q Exactive Plus (Thermo Fisher Scientific ، Waltham ، MA) مع عمود شعري معبأ عبر الإنترنت C18 (هدف جديد ، Woburn ، MA) عن طريق التصفية على طول 225 دقيقة من التدرج 2٪ حتى 40٪ أسيتونيتريل باستخدام نظام EasyLC 1000 uHPLC (Thermo Fisher Scientific، Waltham، MA). تم تشغيل مطياف الكتلة باستخدام وضع الاكتساب المعتمد على البيانات (DDA) top10.

تم إجراء تحليل البيانات في MaxQuant [74] الإصدار 1.5.2.8 باستخدام قاعدة بيانات tritrypDB-43_TbruceiLister427_2018_AnnotatedProteins (16،869 إدخالًا) والإعدادات القياسية ، باستثناء تنشيط التطابق بين ميزة التشغيل وخوارزمية القياس الكمي الخالي من الملصقات (LFQ). تمت إزالة مجموعات البروتين التي تم تمييزها على أنها ملوثات ، وإدخالات عكسية ، وتم تحديدها بواسطة الموقع فقط قبل تحليل المعلومات الحيوية ، بالإضافة إلى مجموعات البروتين التي تحتوي على أقل من 2 ببتيد (1 على الأقل فريد). تم استخراج معلومات إضافية مثل أسماء الجينات والأوصاف من رأس Fasta وإرفاقها بمجموعات البروتين الفردية. بالإضافة إلى ذلك ، حددنا أفضل تقويم العظام لـ Tb927 باستخدام خوارزمية inparanoid [75]. تم إجراء احتساب القيم المفقودة باستخدام توزيع بيتا في حدود 0.2 و 2.5 في المائة من القيم المقاسة للتكرارات الفردية بشكل منفصل. تم إنشاء مخطط PCA باستخدام حزمة R ggbiplot-0.55 ، تم إنتاج خريطة الحرارة بواسطة أمر heatmap.2 من حزمة gplots-3.0.1.1. تم إجراء التجميع باستخدام وظيفة pamk من حزمة fpc-2.2-1 مع إلغاء تنشيط "usepam" و "krange" بين 5 و 9. تقوم الخوارزمية بتقسيم حول مجموعة medoids لمجموعات البيانات الكبيرة ، مع تقدير العدد الأمثل للمجموعات بالأمثل متوسط ​​عرض الصورة الظلية. تم إجراء تخصيب GO باستخدام اختبار فيشر الدقيق ، و ص تم تصحيح القيم باستخدام طريقة Benjamini-Hochberg.

ظروف زراعة المثقبيات وتوليد خطوط الخلايا

تي. بروسي نمت سلالات خلايا PCF 29.13 ، المعدلة وراثيًا لـ T7 RNA polymerase ومانع التتراسيكلين [76] ، في المختبر عند 27 درجة مئوية في وسط SDM-80 يحتوي على الهيمين (7.5 مجم / مل) و 10 ٪ FBS.تم تحويل ناقل pLew100v5 للتعبير RBP6 (هدية لطيفة من البروفيسور Tschudi) باستخدام إنزيم NotI ونقله إلى خط الخلية 29.13. تم تكييف خلايا RBP6 OE لتنمو في وسط SDM-80 الذي لا يحتوي على جلوكوز وتكميله أيضًا بـ 50 ملي مولار من N-acetyl glucose-amine لمنع امتصاص جزيئات الجلوكوز المتبقية من 10 ٪ FBS. تم تحريض بروتين RBP6 المعبر عنه خارج الرحم عن طريق إضافة 10 ميكروغرام / مل من التتراسيكلين في الوسط. تم قياس كثافة الخلايا باستخدام Z2 Cell Counter (Beckman Coulter ، Brea ، CA). خلال التحليلات ، تم الحفاظ على الخلايا في مرحلة نمو السجل الأسي المتوسط ​​(بين 2 × 10 6 و 1 × 10 7 خلية / مل). تم إنشاء خط خلية RBP6 OE _catalase باستخدام بلازميد pT7v5 يحتوي على a ج. حزم تسلسل الكاتلاز ORF (جين cCAT TriTrypDB [67]. تم تحويل البلازميد pT7v5_catalase خطيًا باستخدام NotI ونقله إلى خلايا RBP6 OE. تم اكتشاف نشاط الكاتلاز باستخدام اختبار النشاط البصري البسيط. تم تعليق إجمالي 5 × 10 7 طفيليات في 100 ميكرولتر من برنامج تلفزيوني ووضعها على شريحة مجهرية حجم 20 ميكرولتر من 3٪ H2ا2 تمت إضافته إلى الخلايا ، وخلطه ، وتم مراقبة تكوين الأكسجين (تكوين الفقاعات) بالعين.

عزل حويصلات الميتوكوندريا ، BNE ، وصفحة أصلية صافية عالية الدقة

تم تكييف BNE للميتوكوندريا المتحللة مع dodecylmaltoside ، متبوعًا بتلطيخ النشاط داخل الهلام ، من البروتوكولات المنشورة [11]. باختصار ، تم عزل حويصلات الميتوكوندريا من 5 × 10 8 خلايا عن طريق تحلل الخلايا ناقص التوتر ، وتم تعليق الميتوكوندريا في مخزن مؤقت (750 ملي مولار من حمض أمينوكابرويك ، 50 ملي مولار ثنائي تريس ، 0.5 ملي مولار EDTA درجة الحموضة 7.0 ، مكمل مع EDTA الكامل الخالي من EDTA كوكتيل مثبط البروتياز [روش ، بازل ، سويسرا]) ومحلول لمدة ساعة واحدة على الجليد مع 2 ٪ دوديسيل مالتوسيد. تم نسج العينات عند 16000ز لمدة 30 دقيقة وتم تحديد تركيزات البروتين المحللة بواسطة مقايسة BCA. تم خلط محللة الميتوكوندريا (20 ميكروغرام) مع صبغة تحميل (50 ملي مولار ACA ، 0.5٪ [وزن / حجم] Coomassie Brilliant Blue G-250). بعد الرحلان الكهربائي (3 ساعات ، 150 فولت ، 4 درجات مئوية) ، تم نقل محلولات الميتوكوندريا التي تم حلها إلى غشاء PVDF وتم فحصها بأجسام مضادة مختارة ، أو تم استخدام المواد الهلامية الأصلية مباشرة لتلطيخ النشاط الهلامي للمجمعات التنفسية. تم تحقيق تلطيخ محدد للمركب III عن طريق احتضان الجل في المخزن المؤقت للمقايسة الثالث المركب (1 مجم / مل من 3،3 ′ ديامينوبنزيدين ، 50 ملي فوسفات الصوديوم درجة الحموضة 7.4 ، 75 مجم / مل سكروز) عن طريق التحريض البطيء بين عشية وضحاها. تم تحقيق تلطيخ مركب IV باستخدام محلول مؤقت للتفاعل (50 ملي فوسفات عازلة درجة الحموضة 7.4 ، 1 مجم / مل 3،3 ديامينوبنزيدين ، 24 وحدة / مل كاتلاز ، 1 مجم / مل سيتوكروم ج، 75 مجم / مل سكروز) بين عشية وضحاها. تم تصور المركب V باستخدام المخزن المؤقت لتفاعل ATPase (35 ملي مولار Tris-HCl pH 8.0 ، 270 ملي جليكاين ، 19 ملي MgSO4، 0.3٪ [وزن / حجم] Pb (NO3)2، 11 ملي ATP) للحضانة بين عشية وضحاها عن طريق التحريض البطيء. عولجت عينات الميتوكوندريا للكشف عن المركب II بصبغة تحميل (0.1٪ Ponceau-S ، 50٪ جلسرين) وتم تشغيلها على 3٪ -12٪ من المواد الهلامية الصافية عالية الدقة المتدرجة عالية الدقة (hrCNE). تم تحقيق تلطيخ محدد عن طريق احتضان الجل في محلول تلطيخ: 5 ملي مولار من حمض الهيدروكلوريك 7.4 ، 20 ملي مولار من سوكسينات الصوديوم ، 0.2 ملي مولار فينازين ميثاسولفات ، و 2.5 مجم / مل نيتروترازوليوم كلوريد أزرق.

SDS-PAGE وصمة عار الغربية

تم فصل عينات البروتين على SDS-PAGE ، وتم مسحها على غشاء PVDF (Thermo Fisher Scientific ، Waltham ، MA) ، وتم فحصها باستخدام الجسم المضاد أحادي النسيلة المناسب (mAb) أو الجسم المضاد متعدد النسيلة (pAb). تبع ذلك حضانة مع جسم مضاد للأرنب أو مضاد للفأر مترافق مع HRP ثانوي (1: 2000 ، BioRad). تم تصور البروتينات باستخدام نظام Pierce ECL على أداة ChemiDoc ((BioRad ، Hercules ، CA)). تم استخدام معيار البروتين المعتمد في PageRuler (فيرمنتاس ، فيلنيوس ، ليتوانيا) لتحديد حجم النطاقات المكتشفة. تم تحضير العديد من الأجسام المضادة (anti-Rieske ، و anti-trCOIV ، و anti-SCoAS ، و anti-aconitase ، و anti-NDUFA) لغرض هذه الدراسة. تم استنساخ إطارات القراءة المفتوحة للجينات المعنية دون إشارة توطين الميتوكوندريا المتوقعة في ه. القولونية التعبير البلازميد ، pSKB3. تم الإفراط في التعبير عن البروتينات في BL21 الإشريكية القولونية الخلايا وتنقيتها في ظل ظروف أصلية أو مشوهة. تم إرسال المستضدات إلى Davids Biotechnologie (Regensburg ، ألمانيا) لإنتاج pAb. كانت الأجسام المضادة الأولية المستخدمة في هذه الدراسة على النحو التالي: mAb anti-mitochondrial hsp70 (1: 2000) [77] ، pAb anti-RBP6 (1: 5000 ، هدية سخية من البروفيسور Tschudi) ، pAb anti-BARP و GPEET (1 : 2000 ، 1: 1،000 ، على التوالي ، هدية سخية من البروفيسور روديتي) ، mAb AOX (1: 100) (هدية سخية من الأستاذ شودري) ، mAb41-PDH (1: 100) [77] ، pAb anti- Rieske (1: 1000 ، تم إنتاجه تجاريًا لغرض هذه الدراسة) ، pAb trCoIV (1: 1000 ، تم إنتاجه تجاريًا لغرض هذه الدراسة) ، pAb anti -unit beta ، F1-ATPase (1: 2000) [78] ، pAb anti-SCoAS (1: 1000 ، منتج تجاريًا لغرض هذه الدراسة) ، pAb anti-aconitase (1: 2000 ، منتج تجاريًا لغرض هذه الدراسة) ، pAb anti-AAC (1: 2000) [79] ، anti-SDH1 [80] ، pAb anti-TbIF1 [39] ، pAb anti-PiC (1: 500) [79] ، pAb anti-NDUFA (1: 1،000 ، تجاريًا أنتجت لغرض هذه الدراسة).

ROS الخلوية ، ROS الميتوكوندريا ، وقياسات غشاء الميتوكوندريا (ميكرومتر)

تم تحديد مستويات ROS الخلوية والميتوكوندريا باستخدام 2 ′ ، 7′-dichlorofluorescein diacetate (H2DCFHDA) و MitoSOX Red Mitochondrial Superoxide (Thermo Fisher Scientific Waltham ، MA) ، على التوالي. عولجت الخلايا في مرحلة النمو الأسي بـ 10 ميكرومتر H2DCFHDA أو مع 5 ميكرومتر MitoSOX لمدة 30 دقيقة عند 27 درجة مئوية. تم تكوير ما مجموعه 1 × 10 7 خلية (1300ز، 10 دقائق ، RT) ، مغسول بـ 1 مل من PBS (الرقم الهيدروجيني 7.4) ، معلق في 2 مل من PBS ، وتحليله على الفور بواسطة قياس التدفق الخلوي (BD FACS Canto II Instrument ، BD Biosciences ، سان خوسيه ، كاليفورنيا). تم تحديد ميكرومتر باستخدام صبغة الفلورسنت الأحمر رباعي ميثيل رودامين إيثيل إستر TMRE (Thermo Fisher Scientific Waltham ، MA). تم تلوين الخلايا في مرحلة النمو الأسي بـ 60 نانومتر من الصبغة لمدة 30 دقيقة عند 27 درجة مئوية. تم تكوير الخلايا (1300ز، 10 دقائق ، RT) ، معلق في 2 مل من PBS (الرقم الهيدروجيني 7.4) ، وتحليله على الفور بواسطة قياس التدفق الخلوي (BD FACS Canto II Instrument). تم استخدام العلاج باستخدام البروتونوفور FCCP (20 ميكرومتر) كعنصر تحكم لإزالة الاستقطاب من غشاء الميتوكوندريا. لتقييم تأثير oligomycin و KCN على ميكرومتر ، تم تحضين الخلايا بـ 2.5 ميكروغرام / مل من أوليغوميسين أو 0.5 ملي مولار من KCN في وجود TMRE لمدة 30 دقيقة عند 27 درجة مئوية. لجميع العينات ، تم جمع 10000 حدث. تم تقييم البيانات باستخدام برنامج BD FACSDiva (BD Biosciences ، سان خوسيه ، كاليفورنيا).

في الموقع Δψm القياس

تم إجراء تقدير ميكرومتر في الموقع طيفيًا باستخدام مقياس الفلور الطيفي باستخدام صبغة safranine O (Sigma-Aldrich ، سانت لويس ، MO). تي. بروسي تم إعادة تعليق خلايا PCF (2 × 10 7 خلايا / مل) في مخزن مؤقت للتفاعل يحتوي على ما يلي: 200 ملي سكروز ، 10 ملي مولار HEPES-Na (درجة الحموضة 7.0) ، 2 ملي سكسينات ، 1 ملي MgCl2، و 1 مم EGTA. تم إحداث التفاعل باستخدام الديجيتونين (40 ميكرومتر) ، بينما تم حقن NaCN (1 ملي مولار) و FCCP (5 ميكرومتر) في نقاط زمنية محددة طوال الاختبار. تم الكشف عن التغييرات في مقدار التألق بمرور الوقت على قارئ صفيحة ميكروسكوبية لانهائية M200 (TECAN) (الإثارة = انبعاث 496 نانومتر = 586 نانومتر). تم تسوية القيم وفقًا للمعادلة التالية: تسوية (Eأنا) = هأنا - إيدقيقة/ هـالأعلى - إيدقيقة (هـدقيقة - الحد الأدنى لقيمة المتغير E، Eالأعلى - القيمة القصوى للمتغير E).

قياس استهلاك الأكسجين

تم تقييم معدل استهلاك الأكسجين عند 27 درجة مئوية باستخدام 2 × 10 7 خلايا لكل غرفة أوكسيجراف Oroboros O2K. تم قياس التنفس الداخلي للخلايا ، وكذلك التنفس الناجم عن الركيزة ، في وسط MiR05 (Oroboros ، إنسبروك ، النمسا). تم استخدام ركائز الجهاز التنفسي التالية: 10 ملي سكسينات ، 5 ملي برولين ، أو 10 ملي جلسرين -3 فوسفات. تم تحديد التنفس الحساس لـ SHAM عن طريق حقن 250 ميكرومتر من الشام ، بينما تم تقييم التنفس الحساس لـ KCN بـ 1 ملي مولار من KCN. إذا لزم الأمر ، تم نفاذية الخلايا بـ 4 ميكروغرام من الديجيتونين (سيجما الدريش ، سانت لويس ، ميزوري).

فحص إنتاج ATP

تم قياس إنتاج ATP كما هو موصوف [42]. باختصار ، تم الحصول على كسور الميتوكوندريا الخام من خلايا RBP6 OE عن طريق استخراج الديجيتونين. تم تحفيز إنتاج ATP في هذه العينات عن طريق إضافة 5 ملي مولار من الركائز المحددة (سكسينات ، ألفا كيتوجلوتارات ، جلسرين 3 فوسفات) و 67 ميكرومتر ADP. تم تحضين مستحضرات الميتوكوندريا مسبقًا لمدة 10 دقائق على الجليد باستخدام المانع malonate (6.7 ملم) أو KCN (1 ملم). تم تحديد تركيز ATP بواسطة مقياس اللمعان (Orion II Berthold Detection Systems ، Pforzheim ، ألمانيا) باستخدام مجموعة اختبار التلألؤ الحيوي ATP CLS II (Roche Applied Science ، بازل ، سويسرا).

مورفولوجيا الخلية ومقايسة التألق المناعي

لمقايسة التألق المناعي ، عولجت الخلايا أولاً بحمض ثاني سلفونيك باثوفينانثرولين 5 ملي مولار (BPS) ، وهو مثبط للمعادن ، لتثبيت البروتينات السطحية قبل الحصاد بـ 24 ساعة [28]. بعد ذلك ، تم حصاد الخلايا وتثبيتها في 3.7٪ فورمالديهايد / PBS لمدة 10 دقائق عند درجة حرارة الغرفة. تم تطبيق تعليق الخلية على ساترة مغلفة بالبوليليسين (Sigma-Aldrich ، سانت لويس ، MO). بعد ذلك ، تم تحضين الأغطية باستخدام pAb الابتدائي المضاد لـ procyclin (1: 400) ومضاد BARP (1: 400) متبوعًا بالاحتضان مع Alexa Fluor 488 - جسم مضاد ثانوي مضاد للأرنب من الماعز المترافق. للكشف عن الخلايا غير الحلقية ، تم تعليق الخلايا التي يسببها RBP6 (5 × 10 6) في وسط 80 ميكرولتر واستكملها بـ 20 ميكرولتر من ديكستران ، Alexa Fluor 568 10،000 Mw (Thermo Fisher Scientific Waltham ، MA). بعد ساعة واحدة ، تم إصلاح الخلايا بواسطة الفورمالديهايد ، وتطبيقها على ساترة مغلفة بالبوليليسين. تم بعد ذلك تثبيت الأغطية على شريحة زجاجية باستخدام ProLong Gold Antifade Mountant (Thermo Fisher Scientific Waltham ، MA). تم التقاط الصور باستخدام المجهر الفلوري (مجهر التصوير العالمي Axioplan 2 ، زايس ، أوبيركوشن ، ألمانيا) باستخدام كاميرا CCD (أوليمبوس DP73). لتحديد الخلايا من خلال مورفولوجيتها ، تم حساب 100 خلية وتخصيصها لنوع خلية معين بناءً على حجمها وشكلها وموقعها الحركية بالنسبة للنواة وموضع الحركة الحركية بالنسبة للنهاية الخلفية للخلية (بيانات S1 ).

تحليل التدفق الخلوي

عولجت الخلايا 2 × 10 7 بـ 5 ملي مولار من BPS ، وتم حصادها (1500ز، 10 دقائق ، RT) ، ومعلق في 200 ميكرولتر من 1 × PBS pH 7.4. تم إصلاح الخلايا بإضافة 7.4٪ فورمالدهيد في 1 × PBS pH 7.4 لمدة 15 دقيقة عند درجة حرارة الغرفة. بعد ذلك ، تم غسل الخلايا 3 مرات في 1 × PBS ، وتم وضع علامة عليها باستخدام مضاد BARP (1: 400) ومضاد procyclin (1: 400) في 1 ٪ BSA لمدة ساعة واحدة عند RT ، متبوعًا بالتلطيخ باستخدام Alexa Fluor 488 - جسم مضاد للماعز ألفا-أرنب (1: 400) في 1٪ من مساحة سطح الجسم. تم بعد ذلك غسل العينات ، وتعليقها في 1 مل من 1 × PBS pH 7.4 وتحليلها عن طريق قياس التدفق الخلوي. تم تقييم البيانات باستخدام برنامج BD FACSDiva.

التحليل الأيضي LC-MS

لتحليل التمثيل الغذائي LC-MS ، تم إجراء استخراج العينة كما هو موضح سابقًا [81،82]. باختصار ، تم استخدام 5 × 10 7 خلايا لكل عينة. تم تبريد الخلايا بسرعة في حمام جليدي / إيثانول جاف إلى 4 درجات مئوية ، بالطرد المركزي عند 1300ز، 4 درجات مئوية لمدة 10 دقائق ، يغسل بـ 1 × PBS ، ويعلق في مذيب الاستخلاص (كلوروفورم: ميثانول: ماء ، نسبة الحجم 1: 3: 1). بعد الاهتزاز لمدة ساعة عند 4 درجات مئوية ، تم طرد العينات عند 16000ز عند 4 درجات مئوية لمدة 10 دقائق ، وتم جمع المادة الطافية وتخزينها عند درجة حرارة -80 درجة مئوية. تم إجراء التحليل باستخدام الفصل على 150 × 4.6 مم ZIC-pHILIC (Merck ، Kenilworth ، NJ) على Dionex UltiMate 3000 RSLC (Thermo Fisher Scientific Waltham ، MA) متبوعًا بالكشف الشامل على مطياف الكتلة Orbitrap Fusion (Thermo Fisher Scientific Waltham ، MA) في Glasgow Polyomics.

تحليل احصائي

يتوافق عدد التكرارات والضوابط والاختبارات الإحصائية مع الدراسات المنشورة التي تستخدم تقنيات قابلة للمقارنة ومقبولة بشكل عام في هذا المجال. تم تحليل الفروق الإحصائية باستخدام برنامج Prism (الإصدار 8.2.1 ، برنامج GraphPad). تم حساب المقارنات بين مجموعتين باستخدام أزواج ثنائية الذيل ر اختبار. أ ص قيمة أقل من 0.05 اعتبرت ذات دلالة إحصائية. أجريت تجارب مطياف الكتلة الكمي في أربعة مكررات بيولوجية.


اللطخة الغربية: ركيزة Fischer ECL 2: 1 بدلاً من 1: 1؟ - مادة الاحياء

ألكسندر ل. نيلسن ، /> أ نعمة رجبي & # 8225 أ نوريو كودو ، ب كاثرين لوند & # 248 ، /> ج كارلوس مورينو يرويلا ، /> أ Michael B & # 230k ، /> أ مارتن فونتيناس ، أ أليسيا لوسيدي ، أ أندرياس س مادسن ، & # 167 أ مينورو يوشيدا ب وكريستيان أ. أولسن /> * أ

مركز المستحضرات الصيدلانية الحيوية & amp ؛ قسم تصميم الأدوية وعلم الأدوية ، كلية الصحة والعلوم الطبية ، جامعة كوبنهاغن ، Universitetsparken 2 ، كوبنهاغن ، الدنمارك
بريد الالكتروني: [email protected]

ب مركز راكن لعلوم الموارد المستدامة (S13) ، هيروساوا 2-1 ، واكو ، سايتاما 351-0198 ، اليابان

مركز مؤسسة نوفو نورديسك لأبحاث التمثيل الغذائي الأساسية ، كلية الصحة والعلوم الطبية ، جامعة كوبنهاغن ، بلغدامسفي 3 ب ، كوبنهاغن ، الدنمارك

الملخص

Sirtuin 2 (SIRT2) هو إنزيم بروتين ديسيلاز يزيل مجموعات الأسيتيل ومجموعات الأسيل ذات السلسلة الأطول من بقايا اللايسين المعدلة بعد التحويل. يؤثر على الوظائف البيولوجية المتنوعة في الخلية وقد تم اعتباره هدفًا دوائيًا فيما يتعلق بكل من الأمراض التنكسية العصبية والسرطان. لذلك ، يعد الوصول إلى مركبات الأدوات القوية والمميزة أمرًا ضروريًا للاستمرار في التحقيق في الوظائف المعقدة لهذا الإنزيم. هنا ، قمنا بالإبلاغ عن مجموعة من المجسات الكيميائية القوية والانتقائية والمستقرة في مصل الدم ، والقابلة للذوبان في الماء ، وتمنع نزع الأسيتيل بوساطة SIRT2 وإزالة الميرستول في الخلايا. بالمقارنة مع المشهد الحالي لمثبطات SIRT2 ، فهذه مجموعة فريدة من الميزات المضمنة في مركب واحد. نتوقع أن تجد الأنماط الكيميائية المطورة تطبيقًا واسعًا في استجواب وظائف SIRT2 في كل من الخلايا السليمة والمريضة ، وأن توفر أساسًا لتطوير العلاجات المستقبلية.


دعم المعلومات

S1 التين. Gba1b أدت الطفرات إلى زيادة الجلوكوزيلسيراميد بشكل ملحوظ وانخفاض معتدل في السيراميد.

تستهدف الدهون الدهنية على رؤوس الذبابة من Gba1b المسوخ والضوابط (ن = 3 مكررات بيولوجية). تمثل أشرطة الخطأ SD. (أ) مستويات الجلوكوزيلسيراميد (GluCer) بالنسبة للمعايير الداخلية ، لكل مليغرام من بروتين الرأس. (ب) مستويات 12: 0 سيراميد (سيراميد) بالنسبة للمعايير الداخلية ، لكل مليغرام من بروتين الرأس. *ص & lt 0.05 للطالب ر اختبار.

S2 التين. البروتينات المرتبطة بـ EV و non-EV مع معدل دوران أسرع بشكل ملحوظ في باركين, الوردي 1، و Sod2 المسوخ.

لا تتمتع البروتينات المرتبطة بـ EV بانتشار متزايد لدوران أسرع في أي من المسوخات الثلاثة مقارنةً بالضوابط الخاصة بكل منها (ص & GT 0.05 بواسطة اختبار فيشر الدقيق). تم إجراء جميع القياسات على مستخلصات رأس الذبابة.

S3 التين. Rab11 المعبر عنه خارجيًا ، مثل Rab11 الأصلي ، أكثر وفرة في EVs من Gba1b المسوخ مقارنة بالضوابط.

سائق عموم الخلايا العصبية إيلاف- GAL4 تم استخدامه للتعبير عن Rab11-GFP بتنسيق Gba1b المسوخ والضوابط. تم فحص متجانسات الذبابة الكاملة والحويصلات الصغيرة خارج الخلية المعزولة (sEVs انظر المواد والطرق) باستخدام جسم مضاد لـ Rab11. (أ) صورة تمثيلية لطخة غربية تظهر أصلي (السهم) و GFP الموسومة (رأس السهم) Rab11. (ب) التحديد الكمي لـ Rab11-GFP. تم إجراء ثلاث تجارب مستقلة على الأقل. تمثل أشرطة الخطأ SEM. *ص & لتر 0.05.

يؤكد الشكل S4 الضربة القاضية للمرجع (2) P هوية الأشكال عالية الوزن الجزيئي للبروتين.

في كل مكان Act5C-GAL4 تم استخدام السائق للتعبير عن RNAi ضد المرجع (2) ص في Gba1b المسوخ. تم فحص متجانسات الجسم بالكامل بمصل مضاد إلى المرجع (2) ص. ويرد صمة عار التمثيلية. التحكم في التحميل هو تلطيخ Ponceau-S. تم إجراء ثلاث تجارب مستقلة على الأقل.

S5 التين مينوس إدخال أليل Gba1b له نفس الأنماط الكيميائية الحيوية مثل أليل الحذف.

(أ) صورة تمثيلية والتقدير الكمي للبروتين الموجود في كل مكان غير قابل للذوبان. تم إجراء النشاف الغربي على كسور Triton غير القابلة للذوبان من رؤوس ذباب التحكم البالغ من العمر 10 أيام (Gba1b rv / Gba1b MB03039 ) و Gba1b المسوخ (Gba1b ΔTT / Gba1b MB03039 ). (ب) صورة تمثيلية والتقدير الكمي للذوبان المرجع (2) ص. تم إجراء النشاف الغربي على أجزاء قابلة للذوبان من Triton من Gba1b والسيطرة على الذباب (على النحو الوارد أعلاه). وقد أجريت تجارب على الأقل ثلاث مرات. *ص & lt 0.05 للطالب ر اختبار.


4. مناقشة

قامت الفئران البالغة Rimkla بتخفيض مستويات NAAG في معظم مناطق الدماغ. نظرًا لأننا لم نعثر على أي دليل على التعبير المتغير عن جين NAAG synthetase الثاني ، Rimklb ، و NAA synthase Nat8l ، فمن المحتمل أن تتوافق NAAG المتبقية في فئران Rimkla مع الكمية التي يتم تصنيعها بشكل طبيعي بواسطة NAAGS-I. وجدنا في الحصين مستويات منخفضة من GCPII ، والتي يمكن أن تعوض جزئيًا تخليق NAAG المنخفض. وبالتالي ، قد تكون مساهمة NAAGS-I في النوع البري أقل من المتوقع من القيم المقاسة في الفئران Rimkla. كان الانخفاض النسبي لـ NAAG أكثر وضوحًا في المناطق التي تحتوي عادةً على مستويات عالية من الببتيد (على سبيل المثال ، 8 ٪ من مستوى النوع البري في النخاع أوبوغاتا ، مقارنة بـ 58 ٪ في القشرة المخية الحديثة). وهكذا ، يبدو أن Rimkla يتم التعبير عنه بشكل خاص في أنواع الخلايا / مناطق الدماغ التي تتطلب ارتفاعًا في تركيب NAAG ، مثل ، على سبيل المثال ، الخلايا العصبية الحركية وخلايا العقدة الشبكية. هذا الرأي مدعوم بعلاقة جيدة بين المستويات العالية من NAAGS-II الموضحة في مناطق الدماغ هذه بواسطة لطخة غربية تم الإبلاغ عنها هنا ونشاط المناعة القوي لجسم NAAG الذي تم الإبلاغ عنه سابقًا (Anderson et al. ، 1987 Moffett & Namboodiri ، 2006).

أشارت العديد من الدراسات إلى أن NAAG تلعب دورًا على المدى الطويل وكذلك على المدى القصير / الذاكرة العاملة (للمراجعة: Neale & Olszewski ، 2019). تم اقتراح دور NAAG في الأخير من خلال دراسة حديثة حددت طفرة GCPII في البشر والتي أدت إلى زيادة النشاط الأنزيمي وبالتالي خفض مستويات NAAG وترتبط بنقص في الذاكرة العاملة (Zink et al. ، 2020).علاوة على ذلك ، تتعرض الفئران Shati / Nat8l - / - لضعف في اختبار الانتباه القائم على الكائن (Wulaer et al. ، 2020) ، على الرغم من أنه من غير الواضح ما إذا كان هذا ناتجًا عن نقص في NAAG أو سلائفها NAA ، وكلاهما يتم تقليله في Nat8l - / - الفئران. لا تستبعد الذاكرة العاملة السليمة في الفئران Rimkla - / - ، كما يتضح من الأداء العادي في المتاهة T المتناوبة التلقائية ، دور NAAG في الذاكرة قصيرة المدى ولكنها قد تشير إلى أن تخليق NAAG المعتمد على Rimklb / NAAGS-I مطلوب أو يمكن ، في هذه الحالة ، تعويض فقدان تخليق NAAGS-II المعتمد على NAAG.

إلى جانب الدراسات التي تظهر التأثيرات المثبطة لـ NAAG على اللدونة المشبكية (Adedoyin et al. ، 2010 Lea et al. ، 2001) ، هناك العديد من التقارير التي تشير إلى الدور المعرفي لـ NAAG في الذاكرة طويلة المدى. يمكن لمثبطات NAAG المهينة لـ GCPII أن تمنع عجز الإدراك في نماذج الفئران المختلفة للأمراض العصبية أو التنكسية العصبية (Olszewski et al.، 2012 Hicks et al.، 2017 Zhu et al.، 2017 للمراجعة: Vornov et al.، 2016 Neale & Yamamoto ، 2020). علاوة على ذلك ، كان تثبيط GCPII كافيًا لمنع مضادات مستقبل NMDA MK801 بوساطة تثبيط التعرف على الكائن في تأخير قصير المدى (1.5 ساعة) اختبار NOR (Olszewski et al. ، 2012). علاوة على ذلك ، فإن تثبيط GCPII بواسطة 2-PMPA أو ZJ43 مكّن الفئران البرية من النوع C57BL / 6 لتذكر الكائن المألوف بعد اختبار NOR تأخير 24 ساعة ، وهو ما لا يحدث عادةً في هذه الفئران (Janczura et al. ، 2013). وبالتالي ، يعمل تركيز NAAG المرتفع على تحسين عمليات الإدراك والذاكرة ، ومن المرجح أن يتم ذلك عن طريق تنشيط mGluR3 ، لأن مضادات المجموعة II mGluR LY341495 غالبًا ما تمنع تأثير مثبطات GCPII (Hicks et al. ، 2017 Olszewski et al. ، 2012 Zhu et al. . ، 2017). من ناحية أخرى ، نوضح هنا أن مستويات NAAG المنخفضة بشكل كبير (أو غياب NAAG) مصحوبة بضعف الإدراك في اختبار NOR. وبالتالي ، هناك ارتباط إيجابي واضح بين التعرف على الأشياء وتركيز NAAG ، مما يشير بقوة إلى أن NAAG لا تلعب دورًا معرفيًا فقط في ظل الظروف المرضية عندما يزداد تركيزها بشكل مصطنع. ومع ذلك ، هناك مثال مضاد واحد تم الإبلاغ عنه لـ Nat8l - / - الفئران من خط الماوس المعيب لـ NAA synthase Shati / Nat8l - / -. أظهرت هذه الفئران وإلى نفس المدى الضوابط من النوع البري تمييزًا مهمًا للأشياء بعد تأخير لمدة 24 ساعة (Furukawa-Hibi et al. ، 2012) ، على عكس عناصر التحكم من النوع البري في الدراسة التي أجراها Janczura et al. (2013). من غير المحتمل تأثير الخلفية الجينية ، لأن الفئران في كلتا الدراستين كانت لها خلفية C57BL / 6. ما إذا كان يمكن تفسير هذه النتائج المتناقضة من خلال عمر الحيوانات أو البروتوكولات المحددة لاختبارات NOR غير واضح في الوقت الحاضر.

لقد ثبت جيدًا أن تقوية الذاكرة لمهمة NOR تعتمد على الحُصين (Antunes & Biala ، 2012). اقترحت آلية محتملة لدور معين لـ NAAGS-II المركب في اختبار NOR من خلال الملاحظة أنه في الحصين فقط parvalbumin (علامة لـ GABAergic interneurons) تحتوي الخلايا العصبية الإيجابية على كميات يمكن اكتشافها من NAAGS-II. تمشيا مع توطين NAAGS-II ، كشفت الدراسات الكيميائية المناعية وجود NAAG في الخلايا العصبية الداخلية ولكن ليس الخلايا الهرمية في الحصين (Neale et al. ، 2000). لذلك ، نقترح أن ضعف توحيد الذاكرة في مهمة NOR في الفئران Rimkla قد يكون نتيجة لمدخلات مثبطة أقوى من الخلايا العصبية الداخلية ، الناتجة عن انخفاض تنشيط mGluR3 قبل المشبكي في المشابك GABAergic. وفقًا لهذه الفرضية ، يمكن تفسير التعرف المحسن الملحوظ على الأشياء في مهمة NOR طويلة المدى للفئران البرية التي عولجت بمثبطات GCPII (Janczura et al. ، 2013) من خلال تثبيط أقوى وطويل الأمد لإطلاق GABA بواسطة NAAG. بدلاً من ذلك ، قد تشارك NAAG في الإشارات إلى الوراء (Nordengen et al. ، 2020). قد يؤدي الإطلاق الشجيري لـ NAAG من الخلايا العصبية الداخلية إلى تنشيط mGluR3 قبل المشبكي من المشابك الجلوتاماتيكية وبالتالي يمنع إطلاق الغلوتامات. يتماشى هذا مع الملاحظة التي تشير إلى أن النشاط المناعي للأجسام المضادة لـ NAAG في معظم الخلايا العصبية GABAergic ، على عكس الخلايا العصبية الغلوتامية ، تم العثور عليها في التشعبات وأجسام الخلايا ولكن ليس في المحاور (Moffett & Namboodiri ، 2006). إلى جانب الحُصين ، فإن القشرة المخية ، وخاصة القشرة المحيطة بالحيوان ، ضرورية للتعرف على الأشياء (Antunes & Biala ، 2012) وتحتوي الخلايا العصبية القشرية الداخلية المثبطة على NAAG (Moffet and Namboodiri ، 2006). على الرغم من أننا لم نتمكن من اكتشاف NAAGS-II في المناطق القشرية عن طريق التألق المناعي ، فقد تكون المستويات المنخفضة موجودة (على الأقل في القشرة المخية الحديثة ، كان NAAGS-II قابلاً للاكتشاف عن طريق النشاف الغربي) وقد تلعب أيضًا دورًا في ذاكرة الكائن.

نظرًا لأن فئران Rimkla تُظهر أيضًا تركيزًا منخفضًا من NAA في بعض مناطق الدماغ ، بما في ذلك القشرة المخية الحديثة ، لا يمكننا استبعاد احتمال حدوث عجز في الذاكرة / الإدراك في الفئران Rimkla - / - و Nat8l - / - في الواقع. بواسطة NAA بدلاً من نقص NAAG. ومع ذلك ، لا يوجد حاليًا ما يشير إلى أن NAA قد تعمل كناقل عصبي. على حد علمنا ، لا يوجد مستقبلات NAA ولا دليل على إطلاقه المتشابك. ومع ذلك ، يمكن أن يكون انخفاض تركيزات NAA في الفئران Rimkla يعكس فقدان الخلايا العصبية ، حيث يُنظر إلى NAA عمومًا على أنه علامة على صحة الخلايا العصبية (Moffett et al. ، 2014 Rigotti et al. ، 2007) ، والإدراك العجز عواقب ثانوية.

لا يمكننا استبعاد تفسير بديل محتمل لدور معين لـ Rimkla / NAAGS-II في NOR ، أي وظيفة محددة لـ NAAG2، والذي تم تصنيعه فقط بواسطة NAAGS-II وكان غير قابل للكشف في الفئران Rimkla. الأجسام المضادة NAAG المستخدمة لإثبات وجود NAAG ، على سبيل المثال ، في القشرة الدماغية والحصين (Moffet and Namboodiri ، 2006) ، بواسطة الكيمياء المناعية قد لا تميز بين NAAG و NAAG2 (كوزيك وآخرون ، 2021). علاوة على ذلك ، NAAG2 هي أيضًا ركيزة لـ GCPII (Lodder-Gadaczek et al. ، 2011) وبالتالي يمكن تفسير أوجه القصور في مهمة NOR في الفئران Rimkla أو تحسين الإدراك عند تثبيط GCPII أو نقصه من خلال دور معين لـ NAAG2. ومع ذلك ، ليس لدينا حاليًا أي دليل يدعم هذه الفرضية. يمكن أن تكون تجارب الإنقاذ المعدلة وراثيًا في فئران Rimkla باستخدام ضربة Rimklb طريقة لمعالجة هذا السؤال. ومع ذلك ، فإن الفئران Rimkla هي نظام نموذجي مفيد لمواصلة استكشاف الدور الفسيولوجي لـ NAAG و NAAG2.


شاهد الفيديو: بداية مريبة لبطولة عالم! فيشر - سباسكي 1972. Game 1 (شهر اكتوبر 2022).